ID: 1044200647

View in Genome Browser
Species Human (GRCh38)
Location 8:89431647-89431669
Sequence TTATGTGTTTGAAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044200635_1044200647 22 Left 1044200635 8:89431602-89431624 CCCCCGTCCACCTCTATATTATT No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200640_1044200647 12 Left 1044200640 8:89431612-89431634 CCTCTATATTATTATAGCCTAAT No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200634_1044200647 23 Left 1044200634 8:89431601-89431623 CCCCCCGTCCACCTCTATATTAT No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200636_1044200647 21 Left 1044200636 8:89431603-89431625 CCCCGTCCACCTCTATATTATTA No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200638_1044200647 19 Left 1044200638 8:89431605-89431627 CCGTCCACCTCTATATTATTATA No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200639_1044200647 15 Left 1044200639 8:89431609-89431631 CCACCTCTATATTATTATAGCCT No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200637_1044200647 20 Left 1044200637 8:89431604-89431626 CCCGTCCACCTCTATATTATTAT No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data
1044200643_1044200647 -5 Left 1044200643 8:89431629-89431651 CCTAATGGTCAACAGGATTTATG No data
Right 1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044200647 Original CRISPR TTATGTGTTTGAAGGGAAAA GGG Intergenic
No off target data available for this crispr