ID: 1044203386

View in Genome Browser
Species Human (GRCh38)
Location 8:89462683-89462705
Sequence GATCTTATCAGATTGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044203386_1044203388 23 Left 1044203386 8:89462683-89462705 CCTGCTGTCAATCTGATAAGATC No data
Right 1044203388 8:89462729-89462751 ATGCACATTAAAAATTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044203386 Original CRISPR GATCTTATCAGATTGACAGC AGG (reversed) Intergenic
No off target data available for this crispr