ID: 1044203500

View in Genome Browser
Species Human (GRCh38)
Location 8:89464088-89464110
Sequence GACAATATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044203500_1044203502 5 Left 1044203500 8:89464088-89464110 CCATTGTCCATTTGTATATTGTC No data
Right 1044203502 8:89464116-89464138 CATGCCAAGAAATTCCAATATGG No data
1044203500_1044203503 6 Left 1044203500 8:89464088-89464110 CCATTGTCCATTTGTATATTGTC No data
Right 1044203503 8:89464117-89464139 ATGCCAAGAAATTCCAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044203500 Original CRISPR GACAATATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr