ID: 1044203526

View in Genome Browser
Species Human (GRCh38)
Location 8:89464486-89464508
Sequence GATGGTGAAATAAACTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044203526_1044203532 29 Left 1044203526 8:89464486-89464508 CCCAGGAAGTTTATTTCACCATC No data
Right 1044203532 8:89464538-89464560 AATTTATCCCAATATAATCATGG No data
1044203526_1044203528 -9 Left 1044203526 8:89464486-89464508 CCCAGGAAGTTTATTTCACCATC No data
Right 1044203528 8:89464500-89464522 TTCACCATCAGAATCACATGAGG No data
1044203526_1044203530 2 Left 1044203526 8:89464486-89464508 CCCAGGAAGTTTATTTCACCATC No data
Right 1044203530 8:89464511-89464533 AATCACATGAGGCATGTATTAGG No data
1044203526_1044203531 3 Left 1044203526 8:89464486-89464508 CCCAGGAAGTTTATTTCACCATC No data
Right 1044203531 8:89464512-89464534 ATCACATGAGGCATGTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044203526 Original CRISPR GATGGTGAAATAAACTTCCT GGG (reversed) Intergenic
No off target data available for this crispr