ID: 1044203530

View in Genome Browser
Species Human (GRCh38)
Location 8:89464511-89464533
Sequence AATCACATGAGGCATGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044203525_1044203530 13 Left 1044203525 8:89464475-89464497 CCAGAGAAAAGCCCAGGAAGTTT No data
Right 1044203530 8:89464511-89464533 AATCACATGAGGCATGTATTAGG No data
1044203527_1044203530 1 Left 1044203527 8:89464487-89464509 CCAGGAAGTTTATTTCACCATCA No data
Right 1044203530 8:89464511-89464533 AATCACATGAGGCATGTATTAGG No data
1044203526_1044203530 2 Left 1044203526 8:89464486-89464508 CCCAGGAAGTTTATTTCACCATC No data
Right 1044203530 8:89464511-89464533 AATCACATGAGGCATGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044203530 Original CRISPR AATCACATGAGGCATGTATT AGG Intergenic
No off target data available for this crispr