ID: 1044206503

View in Genome Browser
Species Human (GRCh38)
Location 8:89497067-89497089
Sequence ATTTTTTTACAGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044206503_1044206508 9 Left 1044206503 8:89497067-89497089 CCTTTCCCCATCTGTAAAAAAAT No data
Right 1044206508 8:89497099-89497121 ATCATAGCACGTGCATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044206503 Original CRISPR ATTTTTTTACAGATGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr