ID: 1044207087

View in Genome Browser
Species Human (GRCh38)
Location 8:89503163-89503185
Sequence GGTTTAATGGACTCATGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044207087_1044207093 7 Left 1044207087 8:89503163-89503185 CCCGGTCATGAGTCCATTAAACC No data
Right 1044207093 8:89503193-89503215 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044207087 Original CRISPR GGTTTAATGGACTCATGACC GGG (reversed) Intergenic
No off target data available for this crispr