ID: 1044209401

View in Genome Browser
Species Human (GRCh38)
Location 8:89532975-89532997
Sequence GTGCACTCCACGATTTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044209401_1044209403 8 Left 1044209401 8:89532975-89532997 CCCATGTAAATCGTGGAGTGCAC No data
Right 1044209403 8:89533006-89533028 TATCACTTTCACACCATTCTAGG No data
1044209401_1044209404 9 Left 1044209401 8:89532975-89532997 CCCATGTAAATCGTGGAGTGCAC No data
Right 1044209404 8:89533007-89533029 ATCACTTTCACACCATTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044209401 Original CRISPR GTGCACTCCACGATTTACAT GGG (reversed) Intergenic
No off target data available for this crispr