ID: 1044216442

View in Genome Browser
Species Human (GRCh38)
Location 8:89616638-89616660
Sequence ATAGTCCAGCACATTTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044216442_1044216448 27 Left 1044216442 8:89616638-89616660 CCTCTATAAATGTGCTGGACTAT No data
Right 1044216448 8:89616688-89616710 CGTATTACAACCACCATGCCTGG No data
1044216442_1044216444 -9 Left 1044216442 8:89616638-89616660 CCTCTATAAATGTGCTGGACTAT No data
Right 1044216444 8:89616652-89616674 CTGGACTATGAGCACCATAAGGG No data
1044216442_1044216445 -4 Left 1044216442 8:89616638-89616660 CCTCTATAAATGTGCTGGACTAT No data
Right 1044216445 8:89616657-89616679 CTATGAGCACCATAAGGGCAAGG No data
1044216442_1044216443 -10 Left 1044216442 8:89616638-89616660 CCTCTATAAATGTGCTGGACTAT No data
Right 1044216443 8:89616651-89616673 GCTGGACTATGAGCACCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044216442 Original CRISPR ATAGTCCAGCACATTTATAG AGG (reversed) Intergenic
No off target data available for this crispr