ID: 1044225956

View in Genome Browser
Species Human (GRCh38)
Location 8:89718324-89718346
Sequence AAGGGTTCTAAGGATGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044225951_1044225956 3 Left 1044225951 8:89718298-89718320 CCACTAAAATGTGATATCCAGGT 0: 1
1: 0
2: 3
3: 16
4: 151
Right 1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG 0: 1
1: 0
2: 2
3: 9
4: 145
1044225949_1044225956 4 Left 1044225949 8:89718297-89718319 CCCACTAAAATGTGATATCCAGG 0: 1
1: 0
2: 2
3: 28
4: 306
Right 1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG 0: 1
1: 0
2: 2
3: 9
4: 145
1044225948_1044225956 7 Left 1044225948 8:89718294-89718316 CCTCCCACTAAAATGTGATATCC 0: 1
1: 0
2: 1
3: 31
4: 195
Right 1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG 0: 1
1: 0
2: 2
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044225956 Original CRISPR AAGGGTTCTAAGGATGCTGT TGG Intergenic
900765295 1:4500938-4500960 AGGGGTGCTCAGGATGCTGGTGG - Intergenic
900839780 1:5038953-5038975 AAGGGTGCCAAGGAAGATGTGGG - Intergenic
902153888 1:14467726-14467748 AGGAGTTCAAATGATGCTGTTGG + Intergenic
904007887 1:27373381-27373403 AAGGGTTCTGAGGAGGCTGTGGG + Intronic
904064572 1:27739173-27739195 ATCAGTTCTAAGGATGCTGGAGG + Intronic
906159421 1:43636807-43636829 AAGGTTTCTAAGGGTACTTTGGG - Intergenic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
906899762 1:49821497-49821519 AAAAGTCCTAAGGATGATGTGGG + Intronic
908720242 1:67117686-67117708 AGGGTTTCTAAGGATGATGCTGG + Intronic
917493793 1:175521589-175521611 AAGGTTTCTGAGGATGTTGATGG - Intronic
917650281 1:177069556-177069578 AAGCTTTCTATGGATGCTGCTGG + Intronic
919472499 1:197996660-197996682 AAGGCTACTCAGGAGGCTGTGGG - Intergenic
921730083 1:218568145-218568167 AATGGTTCCAAGGGTCCTGTGGG - Intergenic
923657807 1:235933402-235933424 AGTGGTTGTAAGGATTCTGTGGG - Intergenic
1063146122 10:3296719-3296741 ACGGGTTTGAAGGATGCTGAGGG - Intergenic
1065782606 10:29183898-29183920 AAGGGTGCAGTGGATGCTGTGGG - Intergenic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1069303042 10:66932256-66932278 AAGAGGTTTTAGGATGCTGTAGG + Intronic
1070073020 10:73108015-73108037 ATGGATTCTAAGGATGCTTAGGG - Intergenic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1074037715 10:109757485-109757507 AAAGCTTTTGAGGATGCTGTTGG - Intergenic
1074134642 10:110615946-110615968 AATGGTGCTGAGGATGCTGGTGG - Intergenic
1078703825 11:13718450-13718472 AAGGGTTTTAAGAAAGCTGTTGG - Intronic
1080148447 11:29019237-29019259 AAATGTTTTAAGGAAGCTGTTGG + Intergenic
1080189815 11:29531017-29531039 AAGGGATCTAAAAATGCTGTAGG + Intergenic
1080578782 11:33624023-33624045 CAGGGTCCTCAGCATGCTGTAGG + Intronic
1081256013 11:40896078-40896100 AAGGGTTCCAAGGTTGGAGTTGG - Intronic
1084068225 11:66717803-66717825 TAAGGATCTAGGGATGCTGTGGG - Intronic
1084114101 11:67031826-67031848 AAGGTCTCTAAGCAGGCTGTGGG - Intronic
1084834888 11:71795262-71795284 AAGGGAACAATGGATGCTGTTGG + Intronic
1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG + Intergenic
1088136774 11:106564988-106565010 AAGGGTTGTAAGCATGATGGTGG - Intergenic
1088315440 11:108501682-108501704 AAAGGTTATAATGCTGCTGTTGG - Intergenic
1089441433 11:118520854-118520876 AAGACTTCTAAGGAGGCAGTTGG + Exonic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1092006554 12:5075045-5075067 ACGGGATCTAAGGATGGTGAAGG + Intergenic
1093234198 12:16585990-16586012 CAGTGTCCTAAGGATGCTATTGG - Intronic
1094011178 12:25811433-25811455 ATAGGGTCTAAGGTTGCTGTGGG + Intergenic
1094503238 12:31038524-31038546 AAGGGTCATCAGGAAGCTGTGGG + Intergenic
1096228703 12:49885464-49885486 AAGGTTTCAAAGGATGTGGTGGG - Intronic
1097377608 12:58858482-58858504 AAGGGATCTAAGGAAGCTCTAGG - Intergenic
1102005751 12:109588243-109588265 AAGGGTTGTGAAGCTGCTGTGGG + Intronic
1104553998 12:129783441-129783463 GAGTGTTCTAAGAATACTGTAGG - Intronic
1104730313 12:131102043-131102065 AAGAGTTCTGAGGATTCTGCAGG - Intronic
1106125814 13:26899186-26899208 CAGCGTGCTAAGGAAGCTGTGGG - Intergenic
1108894130 13:55301752-55301774 ATGGCTTCTTAGGAAGCTGTGGG - Intergenic
1115274269 14:31589836-31589858 AATAGCTCTAAGGAAGCTGTTGG + Intronic
1116369641 14:44113139-44113161 AAAGGTCCTAAGGATACAGTTGG + Intergenic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1122663775 14:103315263-103315285 TATGGTTCGAAGGATGCTGGTGG - Intergenic
1126048165 15:44663557-44663579 GCGGGTTCTACCGATGCTGTTGG - Exonic
1126583212 15:50259703-50259725 AAGGGATCGAAGGGAGCTGTGGG - Intronic
1143400891 17:6641176-6641198 ACGGGTTCTAAGGACGCCGGGGG + Exonic
1143545696 17:7593859-7593881 AAGGGAACTAAGACTGCTGTGGG - Intronic
1145202875 17:20962768-20962790 AAATGTTGTAAGGATGCAGTAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149369690 17:55980632-55980654 AAGGGTTCTCAGGAGGCTCCTGG + Intergenic
1150947042 17:69758888-69758910 AAAGGTCCTAAGGTTTCTGTGGG - Intergenic
1153332212 18:3885294-3885316 AAGCTTTCTAATGATGCTCTTGG - Intronic
1153400919 18:4682960-4682982 AAGGGATCTAAGGAAGCTCTAGG + Intergenic
1155281734 18:24247371-24247393 AAGTGTTGTGAGGATGCTGGAGG + Intronic
1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG + Intergenic
1159461357 18:68725466-68725488 CAGGCTTCTAACGTTGCTGTTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1168522305 19:57062115-57062137 GAAGGTTCTTAGGATGCTATAGG + Intergenic
926166064 2:10522680-10522702 AAGGGTGCTGAGGAGGCTGGGGG - Intergenic
929671567 2:43880008-43880030 AAGGGTTGTAAGGATACAATGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942064302 2:172255868-172255890 AAGGTCTCTAGGGATGCTCTTGG - Intergenic
947350783 2:229242658-229242680 AAATGTTTTAAGGAGGCTGTTGG - Intronic
1169786064 20:9360218-9360240 AGGGCTTCTGAGGATGCTGGTGG + Intronic
1169834792 20:9866031-9866053 AAGGGTTTTAAGCAGGGTGTGGG + Intergenic
1170734901 20:19006135-19006157 AAGGGTTGAAGGGCTGCTGTAGG + Intergenic
1176959238 21:15140673-15140695 AGGGGTTCTAAGGCTGCCGTGGG - Intergenic
1185155123 22:49188878-49188900 CGAGGTTCTAAGGATGCTGACGG + Intergenic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
952922542 3:38295988-38296010 AAGGGATCTAAGGAAGCTCTAGG - Intronic
952938541 3:38421595-38421617 AAGGCATATAAGGATGGTGTTGG + Intergenic
952988497 3:38809933-38809955 AAGGCTTCCTAGGAAGCTGTAGG + Intergenic
953306038 3:41830461-41830483 AAGGGTGCTAAGGAAACTTTTGG + Intronic
953929296 3:46997937-46997959 AAGGGTTCTGAGCAGGCTGGTGG + Intronic
956426717 3:69143918-69143940 AAGGATTCTAAGGTTGCTCCTGG - Intergenic
958204992 3:90379358-90379380 AACGTTTCTCAGAATGCTGTTGG + Intergenic
959932190 3:111997169-111997191 AATGGCTCTAAGGAAGTTGTTGG - Intergenic
960232328 3:115243266-115243288 AAGCCTTCTAAGGAAGCTTTAGG - Intergenic
960671986 3:120163166-120163188 AAGGGGACTCAGGAAGCTGTTGG + Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
967107734 3:186267952-186267974 AAGGGTGCAAAGTCTGCTGTGGG + Intronic
967554666 3:190841002-190841024 AAGGGTTGTAATGATACTGATGG + Intergenic
968718707 4:2182152-2182174 AAAGGTACTAAGAATGGTGTTGG + Intronic
969063481 4:4458694-4458716 CACAGTTCTAAGCATGCTGTAGG + Intronic
969757722 4:9161042-9161064 AAGGGAACAATGGATGCTGTCGG + Intergenic
972170429 4:36339148-36339170 AGAGTTTCTAAGGATCCTGTAGG + Exonic
972293908 4:37718077-37718099 AAGGGTCTTGAGTATGCTGTTGG + Intergenic
972410906 4:38793581-38793603 AGTGGTTTTAAGGATGCTGGCGG - Intronic
973222317 4:47742227-47742249 AAGGGTTTTTAGGATACTCTTGG - Intronic
977656675 4:99530022-99530044 AAGAGTTTTAAGGATGCTAGTGG - Intronic
978777300 4:112516454-112516476 AATGGTTCTAAAGCTCCTGTTGG + Intergenic
985327079 4:188783003-188783025 AAGAGTTCTGAGGATGCTGTGGG - Intergenic
985863794 5:2495596-2495618 GTGGGATCTGAGGATGCTGTGGG + Intergenic
986317073 5:6596682-6596704 AAGTGTTCTGAGCATGCTGAAGG + Intergenic
986345690 5:6833378-6833400 GAGGTTTCTAAGGAGGCTTTGGG - Intergenic
987007327 5:13723973-13723995 AAGGGTTGTAATGAGTCTGTGGG + Intronic
992257280 5:74933703-74933725 TAAAGTTCAAAGGATGCTGTTGG - Intergenic
993413964 5:87602456-87602478 AAGGGTTGCAAAGATCCTGTGGG + Intergenic
993905917 5:93622497-93622519 AAGGATGCTATGGCTGCTGTCGG + Intronic
994055969 5:95415719-95415741 AATGTTTCTAAGAATGTTGTTGG - Intronic
996595865 5:125202006-125202028 AAGGATGCAAAGGATGCAGTAGG - Intergenic
999676794 5:154012223-154012245 AAGGATGGTAAGGAAGCTGTTGG + Intronic
1001165771 5:169365416-169365438 AAGGATTCTAAGGTTTCTGCAGG + Intergenic
1001356504 5:171030169-171030191 ATGGGTTGTAAGAATACTGTTGG + Intronic
1002597365 5:180332909-180332931 AAGATTTCAAAAGATGCTGTGGG - Intronic
1002947902 6:1780441-1780463 AAGCGCTCTCAGGAAGCTGTGGG - Intronic
1005934635 6:30511277-30511299 AAGGCTTCTAACCCTGCTGTTGG - Intergenic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1007842947 6:44731597-44731619 CAGGGTTCTGAGGATTCAGTGGG - Intergenic
1010831572 6:80537027-80537049 AATGGTTCTAATGATGTTGTTGG + Intergenic
1015403955 6:132816566-132816588 AAGGCTGCTAAGGATTGTGTTGG + Intronic
1018923233 6:168189984-168190006 AAGCTTTGTAAGGGTGCTGTGGG + Intergenic
1022479942 7:30736405-30736427 ATGATTTCTCAGGATGCTGTGGG + Intronic
1024669758 7:51583834-51583856 AAGAGCTCAAAGGGTGCTGTGGG + Intergenic
1031637499 7:124119526-124119548 AAGGGTTCAAGAGATGATGTGGG + Intergenic
1031822865 7:126526571-126526593 GGGGGTTCTGAGGAAGCTGTGGG - Intronic
1032446077 7:131984750-131984772 AAGGTATCTAAGGATCCAGTAGG + Intergenic
1035746681 8:1966206-1966228 AGGGGCTCTCAGGATGGTGTGGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041141150 8:54820622-54820644 AAGGATTCTCTGCATGCTGTAGG + Intergenic
1043803565 8:84642971-84642993 GAGGGAGCTAAGGATGCTTTTGG + Intronic
1043861116 8:85318292-85318314 AAGGGTTTGAAAGCTGCTGTGGG - Intergenic
1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG + Intergenic
1044266261 8:90185410-90185432 CAGGGTTATAAGGGTGGTGTTGG + Intergenic
1045255455 8:100516826-100516848 AAAGCTACTGAGGATGCTGTTGG - Intronic
1045383737 8:101651549-101651571 AAGTGTTCTGTGGATGCAGTTGG + Intronic
1045643127 8:104273617-104273639 AAGGTTTCTGAGGAAGCTGATGG + Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1050099138 9:2099859-2099881 GAGGGGTCAATGGATGCTGTTGG - Intronic
1053152880 9:35754108-35754130 AATGGCCCTAAGGATGCTCTGGG - Exonic
1056036184 9:82608527-82608549 AAGCTTCCAAAGGATGCTGTTGG + Intergenic
1059042038 9:110825533-110825555 AAGGGTAGTGAGGATGGTGTGGG + Intergenic
1059438798 9:114291226-114291248 AAGCTTTCTAAGGATGCCTTGGG - Intronic
1059882778 9:118710162-118710184 AAGGGTTATAAGGATGGGATTGG - Intergenic
1059939239 9:119341632-119341654 AAGTGTTCTAAGCATGTTGAAGG + Intronic
1060987378 9:127827520-127827542 AAGGATTCAGAGGAAGCTGTTGG + Intronic
1062219767 9:135408988-135409010 AAGGGTGCAAAGGAAGCTGGCGG + Intergenic
1189192496 X:39122593-39122615 AAGGGTGCTGACTATGCTGTTGG + Intergenic
1193543312 X:82797133-82797155 AAGTGTTTTAAAGATGCAGTTGG + Intergenic
1196640876 X:118059163-118059185 AAGTGTTTTAGAGATGCTGTAGG - Intronic
1198252293 X:134891454-134891476 AAGGGTTTTAAAGATGCATTTGG - Intronic
1199458314 X:148054252-148054274 GAGGGTGCTGAGGATGCTGAGGG + Intergenic
1199698542 X:150360838-150360860 CAGGCTTCTTAGGATGCTCTAGG + Intergenic
1200065706 X:153503247-153503269 CAGGGGTCTAAGGAGGCCGTGGG - Intronic
1202029521 Y:20557246-20557268 AAGTTTTCTAATGATGCTGATGG - Intergenic