ID: 1044229537

View in Genome Browser
Species Human (GRCh38)
Location 8:89758118-89758140
Sequence GACCTGCGCTACCTGAGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044229535_1044229537 -10 Left 1044229535 8:89758105-89758127 CCACAAACTCGCCGACCTGCGCT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229534_1044229537 -6 Left 1044229534 8:89758101-89758123 CCTACCACAAACTCGCCGACCTG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229533_1044229537 -5 Left 1044229533 8:89758100-89758122 CCCTACCACAAACTCGCCGACCT 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229530_1044229537 4 Left 1044229530 8:89758091-89758113 CCCACCATTCCCTACCACAAACT 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229527_1044229537 21 Left 1044229527 8:89758074-89758096 CCATCTGCAGCGCCCTGCCCACC 0: 1
1: 0
2: 5
3: 40
4: 465
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229528_1044229537 9 Left 1044229528 8:89758086-89758108 CCCTGCCCACCATTCCCTACCAC 0: 1
1: 0
2: 3
3: 43
4: 452
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229529_1044229537 8 Left 1044229529 8:89758087-89758109 CCTGCCCACCATTCCCTACCACA 0: 1
1: 0
2: 3
3: 34
4: 430
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229531_1044229537 3 Left 1044229531 8:89758092-89758114 CCACCATTCCCTACCACAAACTC 0: 1
1: 0
2: 0
3: 33
4: 350
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1044229532_1044229537 0 Left 1044229532 8:89758095-89758117 CCATTCCCTACCACAAACTCGCC 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044229537 Original CRISPR GACCTGCGCTACCTGAGCCG CGG Exonic