ID: 1044240270

View in Genome Browser
Species Human (GRCh38)
Location 8:89880269-89880291
Sequence GGTTGTGGCAGTTCATATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044240261_1044240270 20 Left 1044240261 8:89880226-89880248 CCCCAAACTGGAAACAACTCCAA No data
Right 1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG No data
1044240268_1044240270 -6 Left 1044240268 8:89880252-89880274 CCTTTAACTGGTAAATGGGTTGT No data
Right 1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG No data
1044240265_1044240270 1 Left 1044240265 8:89880245-89880267 CCAATGTCCTTTAACTGGTAAAT No data
Right 1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG No data
1044240262_1044240270 19 Left 1044240262 8:89880227-89880249 CCCAAACTGGAAACAACTCCAAT No data
Right 1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG No data
1044240263_1044240270 18 Left 1044240263 8:89880228-89880250 CCAAACTGGAAACAACTCCAATG No data
Right 1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044240270 Original CRISPR GGTTGTGGCAGTTCATATAA TGG Intergenic
No off target data available for this crispr