ID: 1044240671

View in Genome Browser
Species Human (GRCh38)
Location 8:89884869-89884891
Sequence CTGAATATGCAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044240668_1044240671 23 Left 1044240668 8:89884823-89884845 CCAATGGTGAATATTCTTAATAA No data
Right 1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044240671 Original CRISPR CTGAATATGCAAATGGACAA TGG Intergenic
No off target data available for this crispr