ID: 1044244071

View in Genome Browser
Species Human (GRCh38)
Location 8:89920465-89920487
Sequence AAGCAGAAATAAGTAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044244069_1044244071 8 Left 1044244069 8:89920434-89920456 CCTTTGGGCTTTTCTTGCTTTGT 0: 1
1: 0
2: 4
3: 37
4: 537
Right 1044244071 8:89920465-89920487 AAGCAGAAATAAGTAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044244071 Original CRISPR AAGCAGAAATAAGTAGGTCA AGG Intronic
No off target data available for this crispr