ID: 1044245682

View in Genome Browser
Species Human (GRCh38)
Location 8:89942149-89942171
Sequence CTTACAACACAGAAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044245678_1044245682 8 Left 1044245678 8:89942118-89942140 CCCAGCACTAAAAGAAGAAAGAG 0: 1
1: 0
2: 3
3: 47
4: 556
Right 1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG No data
1044245679_1044245682 7 Left 1044245679 8:89942119-89942141 CCAGCACTAAAAGAAGAAAGAGA 0: 1
1: 1
2: 5
3: 69
4: 682
Right 1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044245682 Original CRISPR CTTACAACACAGAAGGAGCT AGG Intronic
No off target data available for this crispr