ID: 1044257897

View in Genome Browser
Species Human (GRCh38)
Location 8:90087251-90087273
Sequence ATGTAGAAGTAGAAGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044257894_1044257897 6 Left 1044257894 8:90087222-90087244 CCTCACAGGATTACAGTTTGCAG 0: 1
1: 0
2: 2
3: 10
4: 148
Right 1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044257897 Original CRISPR ATGTAGAAGTAGAAGCTGAA TGG Intronic
No off target data available for this crispr