ID: 1044258010

View in Genome Browser
Species Human (GRCh38)
Location 8:90088611-90088633
Sequence AGCCTTAAAAAAAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 490}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044258010 Original CRISPR AGCCTTAAAAAAAATGAGGT GGG (reversed) Intronic
900851144 1:5144043-5144065 AGCATCAAAAAAAGTGAGGCAGG + Intergenic
900895097 1:5477874-5477896 AGCCTTGATAAAAATGAGCCTGG - Intergenic
901095310 1:6674257-6674279 AGCCTTAAAAAAAAAGTGGGGGG + Intronic
901248964 1:7758283-7758305 GGCATTAAAGAAATTGAGGTTGG - Intronic
901274465 1:7980386-7980408 TGCCTCAAAAACATTGAGGTTGG + Intronic
901429619 1:9205215-9205237 ACCCTTCAAAAAATTGAGATGGG - Intergenic
901819709 1:11820282-11820304 TGTCTTAAAAAAAATGATGCTGG + Intronic
904188484 1:28724676-28724698 AGTCTCAAAAAAAAAGAGGTTGG - Intergenic
904536418 1:31202368-31202390 AGTCTAAAAAAAAATCAGGCCGG + Intronic
904681305 1:32231240-32231262 TGCCTTAAAAAAAAAGTGGTGGG - Exonic
905577283 1:39055564-39055586 AAAATTAAAAAAAATGAGCTGGG + Intergenic
906079625 1:43076215-43076237 AGCCATAAAAAGAATGAAATTGG - Intergenic
906493607 1:46287110-46287132 CGTCTAAAAAAAAATGAAGTTGG - Intronic
906552746 1:46679459-46679481 AACATTAAAAAAAATTAGCTGGG - Intronic
907101319 1:51839320-51839342 AACATTAAAAAAAATTAGCTGGG - Intronic
907200066 1:52718775-52718797 ATGATTAAAAAAAATCAGGTCGG + Intergenic
907345647 1:53777178-53777200 AGTTTTAAAAAAAATTAGCTGGG - Intronic
907698781 1:56761958-56761980 AGCCTTTTAAAAAATGGTGTTGG - Intronic
908496774 1:64702121-64702143 AGGCTTAAATAAAATTAGCTTGG - Intergenic
910571488 1:88709768-88709790 AACCTTAAAAAAAATTATGCTGG + Intronic
910711060 1:90181292-90181314 CGCCTTAAAAGAAAAGAGGCAGG - Intergenic
910767097 1:90792708-90792730 TGTATTAAAAAAAAAGAGGTTGG - Intergenic
910943958 1:92568213-92568235 AACATTAAAAAAAATTAGCTGGG + Intronic
911507904 1:98776378-98776400 GGTCTTTAAAAAAATGAGTTAGG - Intergenic
912198682 1:107430339-107430361 AGCCTTAAAAAAAGTGAGAGGGG - Intronic
912647759 1:111411218-111411240 AGCCATAAAAAAAACAAGATCGG + Intergenic
914229795 1:145755232-145755254 TGCCTCAAAAAAAAAAAGGTGGG + Intronic
914499013 1:148227499-148227521 AGCCCTTTAAAGAATGAGGTAGG + Intergenic
914739303 1:150450444-150450466 AAAATTAAAAAAAATTAGGTGGG + Intronic
915022666 1:152796475-152796497 AGCCTTCAAGTGAATGAGGTAGG + Intronic
916299465 1:163257788-163257810 AGCCTGAAAAAGAAGTAGGTGGG - Intronic
916549738 1:165838749-165838771 TGCATTAAAAAAAATCAGGCTGG + Intronic
916671173 1:167021992-167022014 AGATTTAAAAAAATTGTGGTTGG + Exonic
916835890 1:168544333-168544355 AGCTGTAAAGGAAATGAGGTGGG + Intergenic
916838578 1:168576241-168576263 AGCTGTAAAGGAAATGAGGTGGG - Intergenic
918738810 1:188101546-188101568 AACATTAAAAAAAATTAGGAAGG - Intergenic
921837844 1:219795942-219795964 AGCCTTGAAAAGAAAGAGGTGGG + Intronic
922011022 1:221587699-221587721 GGACTTAAAAAAGATGAGTTAGG + Intergenic
922075237 1:222237119-222237141 AGCAGTAGCAAAAATGAGGTTGG + Intergenic
922133276 1:222800187-222800209 ACCTCTAAAAAAAATGATGTAGG + Intergenic
922437680 1:225622414-225622436 AGCTTTAAAAAAATAGAGATGGG - Intronic
922936252 1:229425340-229425362 TGCCTCAAAAAAAAAGAAGTGGG + Intergenic
924694466 1:246384040-246384062 ACCATTAAAAAAAAGGAGGATGG + Intronic
1063271377 10:4513708-4513730 AGCCCTAAAAAAAATGTTGGGGG + Intergenic
1063824259 10:9876887-9876909 AGTCTTTTAATAAATGAGGTTGG + Intergenic
1063941972 10:11140140-11140162 TGCCTTAAAAGAAATCTGGTTGG + Intronic
1064018453 10:11790877-11790899 AGCTTTATAAAAAATTAGGCAGG + Intergenic
1064138498 10:12770856-12770878 AGCAAGAAAAAAGATGAGGTTGG + Intronic
1064148105 10:12841446-12841468 ATCCTTATAAAAAATGGGGATGG + Intergenic
1064456866 10:15495891-15495913 AGCATTAAAAAAAATGAGAGAGG + Intergenic
1064481229 10:15742828-15742850 AGGCATAAAAGAAATGAGGCAGG - Intergenic
1064933345 10:20651881-20651903 AGTCTAAACAAAAAAGAGGTTGG - Intergenic
1064949987 10:20837408-20837430 AGCCTTCACAGAAATGAGGAGGG - Intronic
1065302764 10:24338409-24338431 GGCCTGAAAAAAAATGACATTGG + Intronic
1065828831 10:29596310-29596332 AGACTAAAAACAAATGAGCTGGG + Intronic
1067679763 10:48424952-48424974 AACATTAACAAAAAGGAGGTAGG - Intronic
1068073663 10:52227164-52227186 AACCTTAAAAATAATGTGATGGG - Intronic
1068264578 10:54629993-54630015 AGCCACAAAAAAAATTAAGTAGG + Intronic
1068704517 10:60058999-60059021 TTCCTTTAAAATAATGAGGTGGG - Intronic
1068988179 10:63126089-63126111 TGGTTTAAAAAAAATGAAGTGGG - Intergenic
1069481560 10:68787316-68787338 AGCTATAAAAAGAATGAGGCAGG - Intronic
1069670708 10:70200332-70200354 AGCTTTCAAAAAAATGGCGTTGG + Intergenic
1070940642 10:80343121-80343143 AGCTATAAAAAACAGGAGGTGGG - Intronic
1071227723 10:83550369-83550391 ATCCTAAAAAAGAATGATGTGGG - Intergenic
1072147815 10:92658249-92658271 AGCCAGAAAAAAAATTAGCTGGG - Intergenic
1072615850 10:97048556-97048578 AGGCCTCAATAAAATGAGGTGGG + Intronic
1073517095 10:104086307-104086329 AGCCCTAGAAAAACTGAAGTTGG + Intergenic
1074080376 10:110163748-110163770 AGCTTTAAAACAAATGAATTTGG + Intergenic
1074137406 10:110639856-110639878 ACCCTGAAAAAGAAGGAGGTAGG - Intergenic
1074707005 10:116141878-116141900 GAGCTTAAAAAAAAAGAGGTCGG - Intronic
1077197124 11:1287333-1287355 AGCTTTAACAAAAAGGGGGTGGG + Intronic
1077840184 11:5965924-5965946 AATGTTAAAAAAAATGAGCTGGG + Intergenic
1078043183 11:7887991-7888013 AGGCTGCAAAAAAATGAGTTTGG + Intergenic
1078493286 11:11789399-11789421 AGCCTTAAAAAAAATGTATGTGG + Intergenic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1079184287 11:18222037-18222059 AGACTAGAAAAAAATGATGTTGG - Intronic
1079661558 11:23043148-23043170 TGACTTAAAAAAAATCAGGCTGG - Intergenic
1080379581 11:31754502-31754524 AGACTTAAAAAAAGTGAAGTAGG - Intronic
1081369291 11:42279275-42279297 AGACTTAAAAAAAAAGAGTGTGG - Intergenic
1084836752 11:71807477-71807499 AGTATGGAAAAAAATGAGGTAGG - Intergenic
1085076246 11:73595499-73595521 AGACTGAAAAAAAATGAGGAGGG - Intronic
1085130334 11:74032702-74032724 ACTCTTAAAAAAAATTAGCTGGG + Intronic
1085873370 11:80376913-80376935 AGCCATATAAAAAATGATCTAGG - Intergenic
1086247472 11:84770950-84770972 AGCCATAAAAAGAATGAAATCGG - Intronic
1086341318 11:85851733-85851755 AGATTTAAAACAAATGATGTGGG + Intergenic
1086466321 11:87057723-87057745 AACCTTAAAAATAAAGACGTTGG + Intronic
1086494612 11:87389258-87389280 AGCCATAAAAAAGATGAGATTGG + Intergenic
1088680383 11:112236502-112236524 TGCATTAAAAAAAATGTGGCAGG - Intronic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1090935162 11:131334890-131334912 ATCCTTCAACAGAATGAGGTTGG + Intergenic
1093192057 12:16086257-16086279 AGCCAAAAAACAAATGAGGAAGG + Intergenic
1093354473 12:18149288-18149310 AGCTTAAAAAAAAATGAGTCTGG + Intronic
1093373309 12:18390509-18390531 AGCCAGAAAAAAAAGGAGGCTGG + Intronic
1093551579 12:20418755-20418777 AGCATTAAAAAAAGTGTTGTGGG - Intronic
1093707914 12:22295753-22295775 AGCCTTATACAAAATCAAGTAGG - Intronic
1094259336 12:28475220-28475242 AGCCTTAAAAAAATGAAGGAAGG - Intronic
1094281817 12:28748358-28748380 AACATTAAAAAAAATTAGCTAGG - Intergenic
1095362049 12:41354187-41354209 AGCCTTAATAGTAATAAGGTAGG + Intronic
1095584265 12:43833626-43833648 AGAATTAAAAAAAATTAGCTAGG + Intergenic
1096340834 12:50797627-50797649 AAAATTAAAAAAAATTAGGTGGG - Intronic
1096434110 12:51573671-51573693 GTCCTTCAAAAAAATGAGATTGG - Intergenic
1096713252 12:53473777-53473799 TGACTTAAAAAAAATGAGAAAGG - Intronic
1097039451 12:56146438-56146460 ACCCTTAAAAAAAATTAGCCAGG + Intergenic
1097101933 12:56596049-56596071 AACCTTATTAAAAATGAGATTGG + Exonic
1097137310 12:56869257-56869279 AGCTTTAAAGAAAACAAGGTAGG + Intergenic
1097313871 12:58151527-58151549 AGACTTAGAAAAAATGTGATTGG - Intergenic
1097608485 12:61785899-61785921 AAACTTAAAAAAAATTAGGGAGG + Intronic
1098688025 12:73450775-73450797 AGTCATAAAAAAAAGAAGGTGGG - Intergenic
1099066977 12:77993157-77993179 CGTCTTTAAAATAATGAGGTGGG + Intronic
1099887282 12:88547391-88547413 AGCCTTAAATAAAATTATGCAGG - Intronic
1100064882 12:90630600-90630622 ATCCTTAAAAAAAATAAGATTGG - Intergenic
1100304078 12:93334446-93334468 AGCCTTAAAAAGATGGAGGCTGG - Intergenic
1101122079 12:101592770-101592792 GGGCTTAAAAAAAATGATCTTGG - Intronic
1103244257 12:119441972-119441994 AACTTTAAAAAAAATGGGCTTGG - Intronic
1103732778 12:123038947-123038969 ACACTTAAAAAAAATTAGCTGGG + Intronic
1104087318 12:125487825-125487847 GGCCTTGAAAAAAATGTAGTAGG - Intronic
1104385887 12:128351223-128351245 AGCCTTTAAAAAAATGAACCAGG - Intronic
1105667111 13:22572421-22572443 ATCCTTAAAAATAATGAAATGGG + Intergenic
1105862027 13:24424242-24424264 TGCATTTAAAAAAATGAGATAGG - Intronic
1105915425 13:24911068-24911090 AGTTTGAAAAAAACTGAGGTTGG - Intronic
1108283819 13:48886037-48886059 AGGCTAAAGTAAAATGAGGTTGG + Intergenic
1108410580 13:50142628-50142650 AACTTAAAAAAAAATGAGGTTGG + Intronic
1108764950 13:53616368-53616390 AACATTTAAACAAATGAGGTTGG - Intergenic
1108946613 13:56033871-56033893 AAGCTTAAAGAAAATGAGTTTGG - Intergenic
1109065779 13:57688082-57688104 GGTTTTAAAAAAAATGGGGTGGG - Intronic
1111015778 13:82380078-82380100 AGGGTTAGTAAAAATGAGGTTGG - Intergenic
1111248121 13:85568836-85568858 AAAATTAAAAAAAATGAGTTAGG - Intergenic
1111419927 13:87998909-87998931 AGCCAAAAAAAAAAGGGGGTGGG - Intergenic
1111792849 13:92880545-92880567 ATCTTTAAAAATAACGAGGTGGG + Intergenic
1112153820 13:96795510-96795532 AGCATTTAAGAGAATGAGGTTGG - Intronic
1112554382 13:100453033-100453055 ATCCTTACAAAAAATTAGCTGGG + Intronic
1112846012 13:103644849-103644871 AGCCATAAAAGAAATGAAGAAGG - Intergenic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113174919 13:107552619-107552641 ACCCTTAGAAAGACTGAGGTGGG - Intronic
1113484070 13:110641874-110641896 ACCCCCATAAAAAATGAGGTGGG - Intronic
1114894463 14:26969826-26969848 ATTCTAAAAAAAAATGAGGCTGG + Intergenic
1115420414 14:33187484-33187506 GGACTTAAAAAAAATTATGTAGG + Intronic
1115838025 14:37432121-37432143 AGCCTCAATAAAAATGGGATAGG - Intronic
1116056022 14:39865005-39865027 AGCTTAAAAAAAATTGACGTGGG - Intergenic
1116466738 14:45242029-45242051 GGACTTAAAAAAAATCAGGTGGG - Exonic
1116804933 14:49484403-49484425 AGCCTATAAGAAAATGAGCTAGG + Intergenic
1116999556 14:51358417-51358439 AGCCTTCAAAATACTAAGGTGGG + Intergenic
1117535983 14:56703932-56703954 AGCCTTTTAAAAATTGAGCTAGG + Intronic
1117561006 14:56938472-56938494 AGCCTTTTAAAAAATGAAATTGG - Intergenic
1118901180 14:69987237-69987259 AGCCTGAAAGAATATGAGGGAGG + Intronic
1119122836 14:72095966-72095988 AACCTTAAAAATAATGAGGAGGG + Intronic
1119747906 14:77057466-77057488 AGAGTTAAAAAGAATGAGGCTGG - Intergenic
1119972161 14:78983556-78983578 AGCCTTAAAAAAAAGTGGGAAGG + Intronic
1120685127 14:87529143-87529165 GGAGTAAAAAAAAATGAGGTGGG - Intergenic
1120866712 14:89301471-89301493 ATCTTAAAAAAAAATGTGGTGGG + Intronic
1121364659 14:93297883-93297905 AGCCTTTACCAAAATGAGGGGGG + Intronic
1124068937 15:26373008-26373030 ATCCTTAAAAAAAGAGAGGGAGG + Intergenic
1124268279 15:28256893-28256915 AGTCTTAAAAAACATGATCTGGG - Intronic
1125178836 15:36858133-36858155 TGTCTTAAAAAAAAAAAGGTTGG - Intergenic
1126288357 15:47042564-47042586 AGCCTTAAAAAGAAAGAAGTTGG - Intergenic
1126440772 15:48685343-48685365 GGCCTTAAAAAGAAGGTGGTGGG + Intergenic
1126522845 15:49615934-49615956 GGTCTCAAAAAAAATGAGTTGGG + Intronic
1126728257 15:51655088-51655110 AGCCTTAAAAAACATCAGATGGG - Intergenic
1126751726 15:51884646-51884668 AGCCTTAAAAAAAAAAAAGTTGG + Intronic
1127242872 15:57137730-57137752 AGACTTAAAGAATATTAGGTCGG + Intronic
1127376911 15:58393495-58393517 AGTTTTAAAAAAAATGAGGTGGG + Intronic
1127737399 15:61856542-61856564 AGACTTAAAAAAAATGAAGCAGG - Intronic
1128686341 15:69688782-69688804 AGCTTAAAAGAAAATGAGGAGGG + Intergenic
1130448366 15:84025716-84025738 AGCCTTCAGGAAAATGAGGAGGG + Intronic
1131167898 15:90155862-90155884 AGTGTTAAAAGAAATTAGGTTGG + Intergenic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1131343084 15:91621172-91621194 TGCCTCAAAAAAAAAGAGGAGGG + Intergenic
1131840095 15:96428085-96428107 AACCTTAAAACAAATGAAATTGG - Intergenic
1132054406 15:98638447-98638469 ATCCTTGAAGAAAATTAGGTGGG - Intergenic
1133252721 16:4494575-4494597 TGCCTTTAAAAAAATAAGTTTGG + Intronic
1134154932 16:11835465-11835487 AGTCTCAAAAAAAATGAGGCTGG - Exonic
1135610096 16:23858968-23858990 AGAATAAAAAAAAATGAGCTAGG + Intronic
1136420412 16:30128862-30128884 TGCCTCAAAAAAAAAAAGGTGGG - Intergenic
1137017161 16:35389154-35389176 AGCTTTAAAAAAATAGAGTTTGG - Intergenic
1137267602 16:46881875-46881897 ACCCTCAAAAAAAATTAGCTAGG + Intergenic
1137631539 16:49949553-49949575 TGCCTTAAAAAAAAAAAGGCAGG + Intergenic
1137711031 16:50567007-50567029 AGTCTTAAAAAAAAAGGGGGGGG - Intronic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1139141818 16:64273238-64273260 AGTATAAAAAAAAAGGAGGTGGG + Intergenic
1139288915 16:65839745-65839767 AACTTTAAAAAAAATGATTTAGG + Intergenic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140205650 16:72930413-72930435 AGCTTAAAAAAAAAAGAGGACGG + Intronic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1142986626 17:3698908-3698930 AGCATTAAAAAAAATAGGTTGGG + Intergenic
1143960256 17:10711415-10711437 AAAGTTAAAAAAAATCAGGTAGG - Intronic
1144172108 17:12667852-12667874 AACTTTAAAAAAAGTGAGGCTGG - Intronic
1144209811 17:13004613-13004635 TGCATTGAAACAAATGAGGTGGG - Intronic
1144820400 17:18069316-18069338 AGAAATAAAAAAAATTAGGTGGG - Intergenic
1145983916 17:29031577-29031599 AGACTTAGAACAAAGGAGGTCGG - Intronic
1146268571 17:31469464-31469486 AATTTTAAAAAAAATGAGCTAGG + Intronic
1147417494 17:40303938-40303960 AGCCTCAAACACAATGAGGTGGG - Exonic
1147700991 17:42394812-42394834 AGCCTTGAAAATATTGAGCTGGG - Intergenic
1148719882 17:49743923-49743945 TGTCTTAAAAAAAAAAAGGTTGG + Intronic
1148849109 17:50546025-50546047 TGGCTAAAAAAAAATGGGGTCGG + Intronic
1148929327 17:51115347-51115369 AACCATAAAAAAAATTAGTTGGG - Intronic
1149738102 17:59015797-59015819 AGCCTTCAAAAAAAGGAAGATGG + Exonic
1151650513 17:75465833-75465855 TGCCATAAAAAAATTGACGTTGG - Intronic
1203166445 17_GL000205v2_random:101331-101353 AGCCTAAAAAATAATGAAATTGG + Intergenic
1153479869 18:5536430-5536452 ACCATTAAAAATAATGATGTGGG + Intronic
1154029529 18:10740650-10740672 ACCCTTACTAAAAATGAGCTTGG - Intronic
1154288255 18:13081145-13081167 GGCCTCATAAAAAATGAGTTAGG + Intronic
1155481392 18:26291815-26291837 TGCCTTAAAATAATTGAGGGCGG + Intronic
1155515078 18:26616313-26616335 AACCTTAAAAACCATGAGGAAGG - Intronic
1155963242 18:32013237-32013259 AGTATTAAACAAAATGAGGCAGG - Intergenic
1156170279 18:34474769-34474791 ATCCATCAAAAAACTGAGGTTGG - Intergenic
1156207593 18:34903291-34903313 AGCCTTAAACATACTGACGTGGG + Intergenic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1158097494 18:53790669-53790691 ACCCTCAAAAAAAATGAAGAGGG - Intergenic
1158360106 18:56662848-56662870 AGTATTAAAAAAAATAAGGTGGG + Intronic
1159137269 18:64351243-64351265 TGCCTTAAAAGGGATGAGGTGGG - Intergenic
1159550358 18:69889046-69889068 ATCATTAAAAAAAATGATCTGGG + Intronic
1160347344 18:78144671-78144693 AACGTTAAAAAAAATAAGGAAGG + Intergenic
1161716543 19:5879366-5879388 AGCCTTACAAAAAATGAGCTGGG + Intronic
1165450675 19:35880349-35880371 TGTCTTAAAAAAAGGGAGGTGGG - Intergenic
1165459129 19:35934005-35934027 TGTCTTAAAAAAAAAGAGATGGG + Intergenic
1167134191 19:47607708-47607730 AGGCTTAAAAAAACAGAGGCCGG + Intergenic
1167914539 19:52730091-52730113 AACCATAAAAAACATGATGTAGG + Intronic
1168683283 19:58331843-58331865 AGCTTTTAAAAAAATAATGTTGG - Intronic
925340037 2:3129876-3129898 AACATTAAAAAAAATTAGCTAGG + Intergenic
925445862 2:3926352-3926374 AGCAGTCAACAAAATGAGGTGGG - Intergenic
925545262 2:5009109-5009131 ATCTTTAAAAAAAATTAGCTGGG - Intergenic
925642642 2:6001066-6001088 AACTTTAAAAAAAATGTAGTAGG - Intergenic
926263422 2:11290425-11290447 ATTTTTAAAAAAAATGAGATGGG - Intronic
926976135 2:18518868-18518890 GGCCTTAAGAAACATGAGCTTGG + Intergenic
927239039 2:20903623-20903645 AGGCTTAAAGAAAAGGGGGTGGG - Intergenic
927775433 2:25899267-25899289 AGTCTCAAAAAAAAAAAGGTAGG + Intergenic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
929367345 2:41175879-41175901 AGTTTTAAAAAAAATGATGGTGG + Intergenic
929425814 2:41843403-41843425 AACCCTAAAAGAAATGATGTGGG + Intergenic
929485589 2:42351213-42351235 AGCCCAAAAACAAATGAGTTAGG - Exonic
929515323 2:42601681-42601703 TGTCTCAAAAAAAATTAGGTGGG - Intronic
929747812 2:44677151-44677173 AGTCCTTTAAAAAATGAGGTTGG - Intronic
930392358 2:50778268-50778290 TGCCTTAAAAACACTGAGTTGGG - Intronic
930693134 2:54384949-54384971 AGCCTTAACAAAGATGGGGACGG + Intergenic
931372528 2:61677049-61677071 TGGTTTAAAAAAAGTGAGGTAGG - Intergenic
931423724 2:62151790-62151812 ACGCTTAAAAAAAATTAGCTGGG - Intergenic
933037849 2:77423271-77423293 TGCCCTAAAATAAATGAGCTTGG - Intronic
933360396 2:81275308-81275330 TGCATGAAAAAAAATGAAGTTGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935029827 2:99311289-99311311 TGCCTCAAAAAAAAGGAGGCAGG - Intronic
935321333 2:101892209-101892231 TGCATTAAGAACAATGAGGTAGG - Intronic
935618629 2:105110151-105110173 AACATTAAAAAAAATTAGCTGGG - Intergenic
935938204 2:108209266-108209288 AGCCTTTAAAAACATGAAATTGG - Intergenic
936520967 2:113212024-113212046 ATCCTTAAAACAGATGAGCTTGG - Intergenic
936618557 2:114072593-114072615 AGCCTTAAAAAAATGGAGTGGGG + Intergenic
936618804 2:114074111-114074133 AGCCTTAAAAAAATGGAGTCAGG - Intergenic
936799689 2:116252292-116252314 TGCCTGAAAAGAAATGAGGGTGG - Intergenic
937570278 2:123349518-123349540 AGCATTAAAAAAAATGTGTTTGG - Intergenic
938426000 2:131188204-131188226 AGTATTTAAAAAAATGATGTAGG + Intronic
938812948 2:134870514-134870536 AGCCTTGCAAATAATGATGTCGG - Intronic
939027708 2:137033771-137033793 AGTGTTAAAAAAAATTAGCTGGG - Intronic
939378494 2:141402159-141402181 AGCTTTAAATCAAATAAGGTTGG + Intronic
939436773 2:142187032-142187054 AATCTTAAAAAAAAAGAGGGGGG - Intergenic
939888612 2:147708708-147708730 AGGCCTAAAAAAAATTAGGAAGG - Intergenic
940322979 2:152396885-152396907 AGCTTTAAAAATAATGATGAGGG - Intronic
940524952 2:154801431-154801453 GCCCTTGGAAAAAATGAGGTAGG - Intronic
940843355 2:158610908-158610930 AGTGTTAAAAAGAATGAGCTTGG - Intronic
941097464 2:161255150-161255172 AGCTTTAAAAAAATTGTGGTAGG - Intergenic
941270418 2:163419811-163419833 TTCCTTGAAAAAAATAAGGTTGG + Intergenic
942288824 2:174449542-174449564 AGCCATAAAAAGAATGAAATAGG + Intronic
942964329 2:181872799-181872821 AACCTTAAAAACAATGAACTTGG - Intergenic
943215301 2:185026046-185026068 TGCCCTAAAAAAATTGAGATGGG - Intergenic
943424603 2:187715251-187715273 AGCATAAGAAAAACTGAGGTAGG + Intergenic
943568145 2:189541118-189541140 ACTTTTAAAAAAAATGACGTGGG + Intergenic
944464310 2:199984835-199984857 AGCTTTAAAAAAAATCATTTAGG - Intronic
944560465 2:200931447-200931469 TGCTTTAAAAAAAAGGAGGAGGG + Exonic
945051397 2:205827563-205827585 AGAGTTAAAAAAAGTGAGGGTGG - Intergenic
945868959 2:215206405-215206427 TTCCTTAAAGAAAATGAGGAAGG + Intergenic
946210177 2:218141362-218141384 ATCTTTAAAAATAATGAAGTAGG + Intergenic
946314410 2:218900278-218900300 AACATTAAAAAAAATTAGCTGGG - Intergenic
946994256 2:225373142-225373164 AGGCTTAAAGAAAATAATGTGGG + Intergenic
947560851 2:231150043-231150065 AGCCATAAAAAAAATTATATAGG + Intronic
948108928 2:235438938-235438960 AGCCTGAGAAAAAATAAGGGAGG - Intergenic
1169429515 20:5524150-5524172 AGGTTAAAAAAAAATGAGGCTGG - Intergenic
1169570002 20:6895971-6895993 AGCCTTATAATAAAAGATGTCGG - Intergenic
1169822360 20:9726244-9726266 AGCCTAAAAAGACATGAGTTTGG - Intronic
1170327093 20:15168684-15168706 AGCCATAAAAAGAATGAGCCAGG + Intronic
1170408215 20:16061965-16061987 AATCTTAACAAAAATGATGTAGG + Intergenic
1170524372 20:17223753-17223775 AGCCTTGTTAAAAATCAGGTTGG - Intergenic
1170617184 20:17963303-17963325 AGCCTTAAAAAAAATCACCTAGG + Intronic
1170649398 20:18226231-18226253 AGACTTAAAAAAAGTAATGTTGG + Intergenic
1172318936 20:33981021-33981043 AGACATAAAACAAATGAGCTTGG - Intergenic
1172985551 20:38985395-38985417 AGGCTTAAAGAAAAGGAAGTAGG + Intronic
1173684781 20:44915499-44915521 ATCTTTAAAAAAATTGAGGCGGG + Intronic
1174183246 20:48688086-48688108 AGCCAAAAAAAAAATGGGGTGGG + Intronic
1175582005 20:60107170-60107192 AAACTTAAAAAGAATGAGGTTGG - Intergenic
1176405310 21:6357765-6357787 AGCCTAAAAAATAATGAAATTGG - Intergenic
1176431847 21:6631338-6631360 AGCCTAAAAAATAATGAAATTGG + Intergenic
1177126165 21:17195240-17195262 GGCCTTAAAACAAATGAGAATGG - Intergenic
1177368164 21:20166432-20166454 AACATTAAAAAAAATAAAGTTGG + Intergenic
1177448962 21:21239819-21239841 AGCATTTTAAAAATTGAGGTTGG + Intronic
1178090917 21:29162377-29162399 TGCATTAAAAAAAATATGGTAGG + Intronic
1178524712 21:33317851-33317873 AGCATTAAAATAAATAAGGAGGG + Intergenic
1178704126 21:34858854-34858876 AGCTTTTAAAAAAATGAGTGAGG - Intronic
1178792940 21:35716960-35716982 AACCCTAAAAATATTGAGGTTGG + Intronic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1180236298 21:46461135-46461157 AGTATTAAAAAAAATTAGCTGGG + Intronic
1182793411 22:32972302-32972324 ATCCTTAACAAGAATGAGGCAGG + Intronic
1182995843 22:34811461-34811483 TGACTGAATAAAAATGAGGTTGG + Intergenic
1183082786 22:35467541-35467563 AGACTTGAAAAAAAGGAGATGGG - Intergenic
1183980472 22:41536886-41536908 GGCTTTAAAAAAAAAAAGGTGGG + Intronic
1184351503 22:43947056-43947078 AGCCTTAAAAAAAAAAAAATCGG + Exonic
949384720 3:3488480-3488502 AGAAGTAAAAAAAATGAGATGGG + Intergenic
949502655 3:4696391-4696413 AGCCTTGAGAAAAATCATGTAGG - Intronic
949544418 3:5060410-5060432 AGCATAAAAAAACATGTGGTTGG - Intergenic
949869163 3:8572686-8572708 AGCATTAAAATAAATAAGGATGG - Intergenic
950402485 3:12780233-12780255 TCCCTAAAAACAAATGAGGTTGG - Intergenic
951194563 3:19809394-19809416 AGAGTTAAAAAAAAAAAGGTGGG + Intergenic
951217121 3:20036168-20036190 AGAATTAAAATAAATAAGGTTGG + Intergenic
951375755 3:21914136-21914158 ACTCTTAAAAAAAATGAAGATGG + Intronic
951400041 3:22221388-22221410 TGCTTCAAAATAAATGAGGTGGG - Intronic
951500691 3:23383822-23383844 AGCCTAAAAAAAAATCATATTGG - Intronic
952056425 3:29452355-29452377 AGCCTCCAAAAAAAGGAGGCAGG - Intronic
952064227 3:29548269-29548291 AGCAATAAAAAAAATTAGCTGGG + Intronic
953321704 3:41978499-41978521 AGCATTAAAAAAAAAAAGATAGG + Intergenic
953792277 3:45957115-45957137 AGCATAAAAAAAAATAAGGTCGG + Intronic
953918079 3:46933324-46933346 TGCCTTAAAAACAAGGAGGCCGG + Intronic
954070439 3:48139097-48139119 GACCTTAGAAAAACTGAGGTTGG - Intergenic
954120310 3:48494592-48494614 AGCCTTAAAAAGAAGGAAATTGG - Intronic
954190655 3:48958013-48958035 AGTTTTAAAAAACATGAAGTGGG - Intronic
954394197 3:50284431-50284453 AGCTTTAAAAAAAATCAGGCCGG + Intronic
954723345 3:52584960-52584982 AGTCTTAAAAAAAATCAAGATGG + Intronic
954815427 3:53276728-53276750 AGCTAAAAAAAAAATGAGGCAGG + Intergenic
954946560 3:54430335-54430357 AGTGTTAAAAATATTGAGGTTGG + Intronic
956019135 3:64914934-64914956 AGCCTGATACAAAATGAGGCTGG + Intergenic
956150085 3:66231934-66231956 AGCCTTTAAAACAACAAGGTAGG - Intronic
956600972 3:71022152-71022174 AACATTAAAAAAAATGAACTTGG - Intronic
957121071 3:76093600-76093622 GTTCTTAAAAAGAATGAGGTTGG - Intronic
957551280 3:81708825-81708847 ACCATCAAAAAAAATGAGGTAGG + Intronic
957991223 3:87630235-87630257 AGCCCTAAAAGGGATGAGGTTGG - Intergenic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
958855882 3:99385010-99385032 AGCCCTAACAAAAATGAATTTGG + Intergenic
959114070 3:102155494-102155516 AGCTTTAAAAAGAATGAGATTGG + Intronic
959925134 3:111912814-111912836 AGGTTTAAAAAAAATGAATTTGG + Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960572072 3:119194852-119194874 AGTCTTAATAAACATTAGGTTGG + Intronic
961133224 3:124488067-124488089 AGCTATAAAGAAAGTGAGGTGGG - Intronic
961211970 3:125132365-125132387 AGCCTTAAGAAAAGTCAGGCAGG + Intronic
961228633 3:125279225-125279247 ATCCTTACAATAAATGAGGATGG - Exonic
965247771 3:166296806-166296828 TGGCTGAAAAAAAGTGAGGTAGG + Intergenic
965333248 3:167403633-167403655 AGCATTAAAAAACATGAAATGGG + Intergenic
965682200 3:171263118-171263140 AGCCTTAAAAACAAGCAAGTTGG + Intronic
965743504 3:171901263-171901285 GTGGTTAAAAAAAATGAGGTTGG + Intronic
966447591 3:180020688-180020710 TGCCTTAAAAAAAATCAGACAGG + Intronic
967009948 3:185423396-185423418 AGTCTTAAAAGAGATGAGGCAGG + Intronic
967022900 3:185538105-185538127 AGACTTAAAAGAAATTATGTAGG - Intronic
967125487 3:186419636-186419658 ACTCTTAAAAAAAAAGGGGTGGG + Intergenic
967246781 3:187495261-187495283 AGCATTCAAAAACATGAAGTAGG + Intergenic
967432974 3:189409537-189409559 AGCCTTAAAAATAATTACGTAGG - Intergenic
967901563 3:194458682-194458704 TGCCTTAAAGAAAATCAGGCCGG - Intronic
968344283 3:197987568-197987590 AGCCAGAAAAAAAATGACTTAGG + Intronic
968740372 4:2326566-2326588 TTCCATAAAAAAAATGATGTTGG + Intronic
969930933 4:10629875-10629897 AGCCTTGAAAAAAATAAATTTGG - Intronic
970047073 4:11866555-11866577 AGCCTCAAAAAATCTGAGGAAGG - Intergenic
971481641 4:27120024-27120046 AGCTTGAAAAAAATTGAAGTAGG - Intergenic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
973176280 4:47209952-47209974 AGCCTTATTAAAGATGAGATAGG + Intronic
974139466 4:57866050-57866072 AAGCTTAAACAAAATGTGGTAGG + Intergenic
974212207 4:58793298-58793320 AGATGTAAAAAACATGAGGTTGG + Intergenic
974358590 4:60845438-60845460 ACACTGAAAAAAAATGAGATTGG + Intergenic
974393003 4:61297667-61297689 AGGGTTAAAAAAAAAAAGGTGGG - Intronic
974846543 4:67357714-67357736 ATCTTTAAAAAGCATGAGGTTGG - Intergenic
975128503 4:70808890-70808912 AGCCTTAAAAAAATTTAGGCTGG + Intergenic
975650419 4:76587422-76587444 ATCCTTGAAATTAATGAGGTGGG - Intronic
977136530 4:93311525-93311547 AGCAAGAAAAAAAATGAGGCAGG + Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
978954474 4:114598073-114598095 AGCCTTAAAAAACGCGAGTTTGG - Intergenic
979510151 4:121544665-121544687 GGGCTTAAAAAAAGTGAGATAGG - Intergenic
979890313 4:126083997-126084019 AGTTTAAAAAACAATGAGGTGGG + Intergenic
980170680 4:129286042-129286064 TGCTTTAAGAAAAATGTGGTTGG + Intergenic
981042956 4:140239795-140239817 AGGGTTATAAAAAATGAAGTTGG + Intergenic
981343504 4:143648933-143648955 AGCATTAAAAAAATAGAGATAGG + Intronic
982030677 4:151297659-151297681 ACCATTAAATAAAATGAGGAAGG + Intronic
982447747 4:155513550-155513572 AGACTTAAAAAAAATGAGAATGG + Intergenic
982768738 4:159376629-159376651 AGCCTTGAACAACATGGGGTTGG - Intergenic
983700293 4:170584001-170584023 ACCCTGAAAAAAGATGAGTTAGG - Intergenic
983912156 4:173251962-173251984 CCACTTAAAAAAAATGAGATAGG + Intronic
984572280 4:181408803-181408825 AGACTTAAGAAAATTGAGATGGG - Intergenic
986513282 5:8531444-8531466 ACACTTAAAAAAAATAAGGTTGG - Intergenic
987229099 5:15873902-15873924 GGCCTCATAAAAAATGAGTTAGG - Intronic
988085080 5:26464714-26464736 TTCCTTAAAAATAATGAGTTTGG + Intergenic
988238114 5:28573392-28573414 AGCCTGAGGAAAAATGAGCTGGG - Intergenic
988457681 5:31401485-31401507 AGAGTTAAAAGAAATGAGGTGGG - Exonic
988534174 5:32051287-32051309 ATCATTAAAAAAAATGATGTGGG - Intronic
988973495 5:36492726-36492748 AGCTTTAAAAAAAATCATATAGG - Intergenic
989286165 5:39702405-39702427 AGCTTTAAAAAACATGATATAGG - Intergenic
989379163 5:40797501-40797523 GTCTTTAAAAAAAATGATGTCGG + Intronic
989431939 5:41365754-41365776 ATACTAAAAAAAATTGAGGTGGG - Intronic
990569384 5:57062620-57062642 AACTTTAAAGAAAATGATGTGGG + Intergenic
990692203 5:58376759-58376781 AGCTTGAAAAAAAATTAGGCCGG - Intergenic
991438503 5:66621130-66621152 ATACTTAAGAAAAATGAAGTCGG + Intronic
992036006 5:72776952-72776974 AGAATTAAAAAGAATGAGGAAGG + Intergenic
992298338 5:75350415-75350437 AATCTTAAAAATAATGAGATTGG - Intronic
992828958 5:80575806-80575828 ACTCTTCAAAAAAATGGGGTTGG + Intergenic
992981184 5:82174941-82174963 CCCCTTAAAAAAACTGAGGAAGG - Intronic
993122449 5:83793199-83793221 AAAATTAAAAAAAATGAGATTGG - Intergenic
993339117 5:86700787-86700809 AGCCTGGATTAAAATGAGGTTGG - Intergenic
996171120 5:120293035-120293057 AGTATAAAAAAAAAAGAGGTAGG - Intergenic
996438925 5:123467419-123467441 AGGCTTAAAAAAATTGTGGTGGG - Intergenic
996560437 5:124822670-124822692 AGCCTTAAAAAAAAAGGGGGGGG + Intergenic
996660290 5:125994776-125994798 AGCCTGAAAACATAAGAGGTTGG + Intergenic
998189993 5:140015544-140015566 AACCTGAAAATGAATGAGGTAGG + Intronic
1000316284 5:160095195-160095217 AGCCTTAAAGCAAATGAAGTAGG - Intronic
1000437161 5:161226400-161226422 AGCATTAAAAAGAATGAGGGTGG + Intergenic
1000616419 5:163432859-163432881 AGACTTAAACAAAATCAGGGGGG - Intergenic
1000841946 5:166230988-166231010 AGCAGCAAAATAAATGAGGTGGG + Intergenic
1001868922 5:175133351-175133373 AGCCAGGAAGAAAATGAGGTGGG - Intergenic
1002831273 6:823593-823615 AGCCTTATGCAAAATGAGATGGG + Intergenic
1003186358 6:3834772-3834794 ACCATTAAAAAAGATCAGGTAGG + Intergenic
1003361469 6:5430150-5430172 TGCCTAAAAAAAGAAGAGGTCGG + Intronic
1003750458 6:9049336-9049358 AATATTAAAAATAATGAGGTCGG - Intergenic
1004021297 6:11778096-11778118 AACCTATAAAAAATTGAGGTGGG + Intronic
1004492643 6:16130280-16130302 AGCCTTCCAAAAGATGAGGAGGG - Intronic
1004875105 6:19943615-19943637 AGACATAAAAAAAATTATGTAGG - Intergenic
1005024963 6:21453791-21453813 AGCATCAAAAAAAATGATGCAGG - Intergenic
1007019462 6:38504845-38504867 AGCCTTCAAAAGAATGAATTAGG + Intronic
1008809529 6:55478787-55478809 AGCCTAAATAAAAATTAGTTTGG - Intronic
1008831150 6:55764271-55764293 AGCCATAAAAAGAATGAAATTGG + Intronic
1009547486 6:65039242-65039264 AGCCTTTTAAAAAATGATGGTGG - Intronic
1009983997 6:70760491-70760513 AGCCTTTAAAAAAATTACCTTGG + Intronic
1010839078 6:80626144-80626166 AACATTAAAAAAATTGAGGCTGG + Intergenic
1011033914 6:82952974-82952996 AACCTTAAAAGCAATCAGGTTGG - Intronic
1012185289 6:96206760-96206782 TGCCTTCAAAAAAAACAGGTGGG - Exonic
1012243375 6:96898632-96898654 AGGCTTAAAAAGAATGAAGAAGG - Intergenic
1012799742 6:103809913-103809935 TGCCTTAAAATAAATGTGGTAGG - Intergenic
1012821964 6:104096046-104096068 AGACATATTAAAAATGAGGTTGG - Intergenic
1013052015 6:106545680-106545702 TGCCTCAAAAAAAAAGAGTTAGG - Intronic
1013444015 6:110202852-110202874 AGCCTAAAATAAAATAAAGTGGG + Intronic
1014217099 6:118762747-118762769 AGCCATAAAAAGAATGAAATTGG - Intergenic
1015387878 6:132646730-132646752 TTCCTTACAAAAAATGATGTTGG - Intergenic
1015612783 6:135043684-135043706 AGCATTATAATAAAGGAGGTAGG + Intronic
1015658125 6:135542949-135542971 AGCCTTGTGAAAAATGAAGTTGG - Intergenic
1016163633 6:140911859-140911881 ATACTTAAAAATAATGAGGCAGG + Intergenic
1016784709 6:147997627-147997649 AACTTTAAAACAAATGCGGTAGG + Intergenic
1017144613 6:151223114-151223136 AGCCTTTCAAAAAATGGTGTTGG - Intergenic
1017469790 6:154728125-154728147 CCCATTAAAAAAAATGAGATAGG + Intergenic
1017916622 6:158836378-158836400 TGCCTTATAAAAATTGAGGCAGG + Intergenic
1017959888 6:159212526-159212548 ATACTTGAAAAAAATGGGGTTGG + Intronic
1018003371 6:159598973-159598995 ATCCTTAAGAAAAATGAGTATGG + Intergenic
1020444316 7:8253519-8253541 ACCCTTAAAGAAAATGGGTTTGG + Intronic
1021388783 7:20066733-20066755 AGCCTCAGAAAACATGATGTTGG + Intergenic
1021462538 7:20904767-20904789 AGTCTTAGATAAAATGAGCTAGG - Intergenic
1021500189 7:21324154-21324176 AGACTTAAAAATAGTAAGGTAGG - Intergenic
1021567196 7:22027391-22027413 GGTCTTTAAAAAAATGATGTTGG - Intergenic
1021987953 7:26115359-26115381 AGCCCTCAAAAAAGTGAGGTTGG - Intergenic
1022315876 7:29245115-29245137 AGTCTTAATAAAAAATAGGTAGG - Intronic
1023091588 7:36622743-36622765 ATCCTTAAAAAATATGAAATGGG + Intronic
1024664098 7:51528798-51528820 GGCCTTTACAAAAGTGAGGTAGG - Intergenic
1024690092 7:51791048-51791070 GGCCTTAAAAACAATAATGTAGG + Intergenic
1024713684 7:52047877-52047899 AGCTTTCAAAAATATGAGATTGG + Intergenic
1026504495 7:70970642-70970664 AGCCTGAAACAAAAGGAGGGAGG - Intergenic
1027433366 7:78137096-78137118 TGACTTTAAAAAAATGATGTAGG + Intronic
1027751066 7:82147810-82147832 AGCCTCAAAGAACATTAGGTTGG + Intronic
1027872793 7:83731440-83731462 AGGCTCTAAAAAAAGGAGGTTGG + Intergenic
1027911011 7:84250658-84250680 AGCATTAAAAAAAATTACATTGG - Intronic
1028075224 7:86504532-86504554 AGGTTTAACAAAAATGAGGTGGG - Intergenic
1028696953 7:93725219-93725241 AGCCTTAGAGAAGATCAGGTGGG + Intronic
1029323648 7:99786996-99787018 AGCTTTAAAAAACATGATGAAGG - Intergenic
1029890606 7:103925702-103925724 AGCCTTAAAAGAAATCATTTTGG + Intronic
1030410529 7:109173022-109173044 AGCCTTAAAATAAATGTGACTGG - Intergenic
1030671490 7:112342913-112342935 AACATGAAAAAAAATGAAGTAGG + Exonic
1031466072 7:122113775-122113797 AGACTAAAAAAAAAGGAGTTTGG + Intronic
1031927869 7:127655286-127655308 AACCTTAAACAAAATAATGTAGG - Intronic
1031979180 7:128113332-128113354 TGCCTCCAAAAAAATGAGTTGGG + Intergenic
1032520710 7:132542026-132542048 TGCTTTAAAAAAAATGAAATAGG + Intronic
1032864557 7:135913018-135913040 AGTATTTAAAAAAATTAGGTTGG - Intergenic
1033290992 7:140082597-140082619 TGCCTTAAAAAAAAAAAAGTAGG + Intergenic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1034632640 7:152542781-152542803 AGCCTTAAAAAGTATGGGGCTGG + Intergenic
1037136503 8:15468937-15468959 TGACTTAAAAATAATGAGGGAGG + Intronic
1037151997 8:15648424-15648446 AGCCTTAAAGAATAAGACGTTGG + Intronic
1038321545 8:26531789-26531811 AGGCAGAAAAAAAATGAAGTAGG + Intronic
1039214567 8:35255428-35255450 AGATTAAAAAAAAATGATGTTGG - Intronic
1039239981 8:35545678-35545700 ATCCGTCTAAAAAATGAGGTAGG - Intronic
1040082808 8:43306166-43306188 AGCTTTAAAAAAAAGTAGGTAGG + Intergenic
1040955486 8:52975701-52975723 AGGGCTAACAAAAATGAGGTGGG - Intergenic
1041380547 8:57250208-57250230 AGACTGAAAAAAAATCAGGAAGG - Intergenic
1042043366 8:64620023-64620045 AACCTTAAAAAAAATTAGCCAGG + Intronic
1042243562 8:66688937-66688959 AGCCTTTAATAAAATGGTGTAGG - Intronic
1042686339 8:71445200-71445222 AGTTTTAAAAAGAATGAGGATGG - Intronic
1042911971 8:73837210-73837232 TGCATTTAAAAAAATGAAGTGGG + Intronic
1043157989 8:76810010-76810032 AACCTTCAAAAAAATGGGGAAGG - Intronic
1043309005 8:78834891-78834913 AGCCATAAAAAAAAGCAGGTTGG - Intergenic
1043589125 8:81807627-81807649 AACTTTTAAATAAATGAGGTTGG + Intronic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1045464229 8:102454421-102454443 AACCTTAAAAATAATTAGCTGGG + Intergenic
1045781940 8:105875596-105875618 AGTCTTAAAAAAAATTATTTAGG - Intergenic
1046564699 8:115884444-115884466 ACGCTTAAAAAGAAAGAGGTGGG + Intergenic
1046966236 8:120168857-120168879 TGCCTCAAAAAAAACGGGGTTGG - Intronic
1047148376 8:122231896-122231918 ATCTTTAAAAAATATAAGGTGGG + Intergenic
1047656795 8:126986022-126986044 AGCCTTAAAAAATCTGGGGGAGG - Intergenic
1047790849 8:128202224-128202246 GTCCTTTAAAAAAATGTGGTGGG + Intergenic
1048072244 8:131033966-131033988 AGGCTTTAAAAAAATAATGTCGG - Intronic
1048761166 8:137796953-137796975 AGACTAAAAAATAATGATGTGGG + Intergenic
1048839841 8:138555697-138555719 AGTCTTCAAAGAAGTGAGGTAGG - Intergenic
1048902407 8:139051413-139051435 AGAATTAAAAAAAATGTGATAGG - Intergenic
1048935895 8:139356678-139356700 AGACTGAAAAATAATGATGTAGG - Intergenic
1048975504 8:139670816-139670838 AACGTTAAAAACAATGTGGTAGG + Intronic
1049132105 8:140855290-140855312 AGACTTAAAAAAAAAGGGGGGGG + Intronic
1050451926 9:5790983-5791005 GGCCTTGAAAAAAATAAAGTAGG + Intronic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1051038533 9:12777985-12778007 AGTCTTAATAAATATTAGGTTGG - Intronic
1051883179 9:21861060-21861082 AGACTTAAAAAAAATAAACTTGG - Intronic
1052434838 9:28413234-28413256 ACCCTTAAACAATATGGGGTGGG - Intronic
1052697416 9:31895880-31895902 AGTCTGAAAAAAAATGAAGTAGG + Intergenic
1052967270 9:34349793-34349815 AGCCATAAAAAAAAATAGGATGG + Intergenic
1053094871 9:35317359-35317381 AGCATTAAAAAAAATCAGCTGGG - Intronic
1053870269 9:42484219-42484241 AGCCTAAAAAAAAATCAGTGGGG + Intergenic
1055098946 9:72443170-72443192 TGCCTCAAAAAAAAAGAGCTAGG - Intergenic
1055336992 9:75242552-75242574 TGCCTTAGAACAAATGAGTTGGG + Intergenic
1057171875 9:92967867-92967889 AGCCTTAAACAGAAGGAGGCCGG - Intronic
1057532775 9:95867696-95867718 AGCCTTAAATAAACAAAGGTAGG - Intergenic
1058312944 9:103528899-103528921 TCTCTTAAAAAAAATGAGGTTGG + Intergenic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1059719604 9:116946699-116946721 AGCCTTTAAGAAAAAGAGGAAGG + Intronic
1059842391 9:118232006-118232028 AGCCTAAATAGAAATGAGTTAGG - Intergenic
1060164680 9:121400833-121400855 ATTCTTTTAAAAAATGAGGTGGG - Intergenic
1060325343 9:122609194-122609216 TGTCTTAAAAATAATGATGTAGG + Intergenic
1061375562 9:130222447-130222469 AGGGTTAAAAAAAATAAGGCTGG - Intronic
1061689187 9:132311261-132311283 TGCTTAAAAAAAAATGAGGCTGG - Intronic
1061995917 9:134185703-134185725 AACATTAAAAAAAATGAGCTGGG + Intergenic
1203439692 Un_GL000195v1:177370-177392 AGCCTAAAAAATAATGAAATTGG - Intergenic
1185430983 X:11808-11830 AGGGTTAGCAAAAATGAGGTTGG - Intergenic
1185440249 X:224205-224227 AGGGTTAGCAAAAATGAGGTTGG - Intergenic
1185937130 X:4270229-4270251 AGCATTAAAAAAAATGTGATTGG + Intergenic
1188004341 X:25006934-25006956 AGCCTCAAAAAAAAAAATGTGGG - Intronic
1188514653 X:30972320-30972342 AGCCTCAAGAGAAATGAGGAAGG - Intronic
1188692350 X:33146045-33146067 ATATTTAAAAAAAATGAGCTGGG - Intronic
1188755546 X:33956664-33956686 AGCCTGAAAAATAATGTTGTAGG - Intergenic
1189425029 X:40891969-40891991 AGCCTTAAAAACAATGACTGGGG - Intergenic
1189620182 X:42828304-42828326 AGCAGTAAAAACAATGATGTGGG + Intergenic
1190761188 X:53439524-53439546 AGCCTTAAAAGTGAGGAGGTGGG - Intergenic
1192472647 X:71412423-71412445 TGATTAAAAAAAAATGAGGTTGG - Intronic
1193714446 X:84921101-84921123 ACCATTAAAAAAAATGATATTGG - Intergenic
1193843475 X:86438525-86438547 ACCCATAAAAAGAATGAGTTCGG - Intronic
1193928606 X:87523498-87523520 AGTATTCAAAAAAATGATGTAGG + Intronic
1194349645 X:92810137-92810159 ACCATTAAAAAAAATGAGTATGG + Intergenic
1195005124 X:100678353-100678375 AGCCTTCAAACAAGTGAGGATGG + Intronic
1195102112 X:101565310-101565332 AGCCCCACAAAAACTGAGGTGGG + Intergenic
1196604363 X:117639611-117639633 AACCTTAAAAATAATGACGTTGG + Intergenic
1197025747 X:121747669-121747691 AGACTTAAGAAAAATGACTTGGG + Intergenic
1197144721 X:123158766-123158788 CGTCTCAAAAAAAATGAGCTGGG + Intergenic
1197398554 X:125959580-125959602 ATCCTTAAATACAATGAGCTTGG - Intergenic
1198078480 X:133216490-133216512 AATCTTAAAAAAAAAGAGGTAGG - Intergenic
1199926910 X:152477076-152477098 AGCCTCAAAAAAAATAATTTTGG - Intergenic
1200336120 X:155353376-155353398 AGCATTTAAAAAAAAAAGGTGGG + Intergenic
1200350350 X:155487851-155487873 AGCATTTAAAAAAAAAAGGTGGG - Intergenic
1201334527 Y:12865896-12865918 TGCATTTAAAATAATGAGGTTGG + Intergenic
1202065627 Y:20936574-20936596 AGGCTTAAAAAAAATCACATAGG - Intergenic