ID: 1044259281

View in Genome Browser
Species Human (GRCh38)
Location 8:90098547-90098569
Sequence CACCCTAGAGGGCTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044259281_1044259289 14 Left 1044259281 8:90098547-90098569 CCTTCCTGCAGCCCTCTAGGGTG No data
Right 1044259289 8:90098584-90098606 GCCCAGGTCCTGCGCCTAGGAGG No data
1044259281_1044259291 15 Left 1044259281 8:90098547-90098569 CCTTCCTGCAGCCCTCTAGGGTG No data
Right 1044259291 8:90098585-90098607 CCCAGGTCCTGCGCCTAGGAGGG No data
1044259281_1044259287 -2 Left 1044259281 8:90098547-90098569 CCTTCCTGCAGCCCTCTAGGGTG No data
Right 1044259287 8:90098568-90098590 TGCAGGGTGCAGAGACGCCCAGG No data
1044259281_1044259288 11 Left 1044259281 8:90098547-90098569 CCTTCCTGCAGCCCTCTAGGGTG No data
Right 1044259288 8:90098581-90098603 GACGCCCAGGTCCTGCGCCTAGG No data
1044259281_1044259293 18 Left 1044259281 8:90098547-90098569 CCTTCCTGCAGCCCTCTAGGGTG No data
Right 1044259293 8:90098588-90098610 AGGTCCTGCGCCTAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044259281 Original CRISPR CACCCTAGAGGGCTGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr