ID: 1044265459

View in Genome Browser
Species Human (GRCh38)
Location 8:90176346-90176368
Sequence AAGGGTACAGACCCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044265459_1044265462 -9 Left 1044265459 8:90176346-90176368 CCTGCAGCAGGGTCTGTACCCTT No data
Right 1044265462 8:90176360-90176382 TGTACCCTTGTTGGAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044265459 Original CRISPR AAGGGTACAGACCCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr