ID: 1044273393

View in Genome Browser
Species Human (GRCh38)
Location 8:90272841-90272863
Sequence CTCTGAAGTCAGATGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044273393_1044273397 28 Left 1044273393 8:90272841-90272863 CCTTGTGCCATCTGACTTCAGAG No data
Right 1044273397 8:90272892-90272914 CTCCCATTACATAATCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044273393 Original CRISPR CTCTGAAGTCAGATGGCACA AGG (reversed) Intergenic
No off target data available for this crispr