ID: 1044275461

View in Genome Browser
Species Human (GRCh38)
Location 8:90294392-90294414
Sequence AGGTAGAAGAAAAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044275461_1044275465 12 Left 1044275461 8:90294392-90294414 CCTTCCTCTTTTTTCTTCTACCT No data
Right 1044275465 8:90294427-90294449 CTTTTATTTTGTCTTCAAGCAGG No data
1044275461_1044275466 28 Left 1044275461 8:90294392-90294414 CCTTCCTCTTTTTTCTTCTACCT No data
Right 1044275466 8:90294443-90294465 AAGCAGGAATTCTAAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044275461 Original CRISPR AGGTAGAAGAAAAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr