ID: 1044277687

View in Genome Browser
Species Human (GRCh38)
Location 8:90321592-90321614
Sequence TACTTGTACATTCTGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044277687_1044277694 1 Left 1044277687 8:90321592-90321614 CCAGGGACCAGAATGTACAAGTA No data
Right 1044277694 8:90321616-90321638 CTGGGCGGGAGAACACTGTAGGG No data
1044277687_1044277693 0 Left 1044277687 8:90321592-90321614 CCAGGGACCAGAATGTACAAGTA No data
Right 1044277693 8:90321615-90321637 GCTGGGCGGGAGAACACTGTAGG No data
1044277687_1044277695 2 Left 1044277687 8:90321592-90321614 CCAGGGACCAGAATGTACAAGTA No data
Right 1044277695 8:90321617-90321639 TGGGCGGGAGAACACTGTAGGGG No data
1044277687_1044277696 5 Left 1044277687 8:90321592-90321614 CCAGGGACCAGAATGTACAAGTA No data
Right 1044277696 8:90321620-90321642 GCGGGAGAACACTGTAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044277687 Original CRISPR TACTTGTACATTCTGGTCCC TGG (reversed) Intergenic
No off target data available for this crispr