ID: 1044277695

View in Genome Browser
Species Human (GRCh38)
Location 8:90321617-90321639
Sequence TGGGCGGGAGAACACTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044277687_1044277695 2 Left 1044277687 8:90321592-90321614 CCAGGGACCAGAATGTACAAGTA No data
Right 1044277695 8:90321617-90321639 TGGGCGGGAGAACACTGTAGGGG No data
1044277686_1044277695 3 Left 1044277686 8:90321591-90321613 CCCAGGGACCAGAATGTACAAGT No data
Right 1044277695 8:90321617-90321639 TGGGCGGGAGAACACTGTAGGGG No data
1044277690_1044277695 -5 Left 1044277690 8:90321599-90321621 CCAGAATGTACAAGTAGCTGGGC No data
Right 1044277695 8:90321617-90321639 TGGGCGGGAGAACACTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044277695 Original CRISPR TGGGCGGGAGAACACTGTAG GGG Intergenic
No off target data available for this crispr