ID: 1044278194

View in Genome Browser
Species Human (GRCh38)
Location 8:90326415-90326437
Sequence AAACTCAACATGTCTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044278191_1044278194 0 Left 1044278191 8:90326392-90326414 CCTGACTGTTCCACAGGCTCCTG No data
Right 1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG No data
1044278189_1044278194 30 Left 1044278189 8:90326362-90326384 CCATTTCTAGCTGACTTTTGTCT No data
Right 1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG No data
1044278192_1044278194 -10 Left 1044278192 8:90326402-90326424 CCACAGGCTCCTGAAACTCAACA No data
Right 1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044278194 Original CRISPR AAACTCAACATGTCTAAAAA TGG Intergenic
No off target data available for this crispr