ID: 1044280477

View in Genome Browser
Species Human (GRCh38)
Location 8:90349656-90349678
Sequence CAGTTTGACTGGTGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044280469_1044280477 19 Left 1044280469 8:90349614-90349636 CCTGTGTTCTCTATCCAACATCC No data
Right 1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG No data
1044280470_1044280477 5 Left 1044280470 8:90349628-90349650 CCAACATCCTGTGACTCTTGAGA No data
Right 1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG No data
1044280471_1044280477 -2 Left 1044280471 8:90349635-90349657 CCTGTGACTCTTGAGACCTTACA No data
Right 1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044280477 Original CRISPR CAGTTTGACTGGTGGGAAGA GGG Intergenic
No off target data available for this crispr