ID: 1044280690

View in Genome Browser
Species Human (GRCh38)
Location 8:90352059-90352081
Sequence GTGAGAACAAACTCTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044280690_1044280692 0 Left 1044280690 8:90352059-90352081 CCTGCAGGAGAGTTTGTTCTCAC No data
Right 1044280692 8:90352082-90352104 TGTTCCTGGCCATAGTAGATTGG No data
1044280690_1044280696 18 Left 1044280690 8:90352059-90352081 CCTGCAGGAGAGTTTGTTCTCAC No data
Right 1044280696 8:90352100-90352122 ATTGGTCATAGGAAGACAACTGG No data
1044280690_1044280694 7 Left 1044280690 8:90352059-90352081 CCTGCAGGAGAGTTTGTTCTCAC No data
Right 1044280694 8:90352089-90352111 GGCCATAGTAGATTGGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044280690 Original CRISPR GTGAGAACAAACTCTCCTGC AGG (reversed) Intergenic
No off target data available for this crispr