ID: 1044282398

View in Genome Browser
Species Human (GRCh38)
Location 8:90371324-90371346
Sequence GGTGTTGAAGGAGGACTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044282398_1044282408 28 Left 1044282398 8:90371324-90371346 CCCAGTAGTCCTCCTTCAACACC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282398_1044282409 29 Left 1044282398 8:90371324-90371346 CCCAGTAGTCCTCCTTCAACACC No data
Right 1044282409 8:90371376-90371398 ACATCTAGCAGCCTGACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044282398 Original CRISPR GGTGTTGAAGGAGGACTACT GGG (reversed) Intergenic
No off target data available for this crispr