ID: 1044282400

View in Genome Browser
Species Human (GRCh38)
Location 8:90371333-90371355
Sequence GGCAATGTGGGTGTTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044282400_1044282409 20 Left 1044282400 8:90371333-90371355 CCTCCTTCAACACCCACATTGCC No data
Right 1044282409 8:90371376-90371398 ACATCTAGCAGCCTGACCTAGGG No data
1044282400_1044282408 19 Left 1044282400 8:90371333-90371355 CCTCCTTCAACACCCACATTGCC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044282400 Original CRISPR GGCAATGTGGGTGTTGAAGG AGG (reversed) Intergenic
No off target data available for this crispr