ID: 1044282408

View in Genome Browser
Species Human (GRCh38)
Location 8:90371375-90371397
Sequence CACATCTAGCAGCCTGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044282402_1044282408 7 Left 1044282402 8:90371345-90371367 CCCACATTGCCTCCCCATTCTAC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282407_1044282408 -7 Left 1044282407 8:90371359-90371381 CCATTCTACAACGAAGCACATCT No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282406_1044282408 -6 Left 1044282406 8:90371358-90371380 CCCATTCTACAACGAAGCACATC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282405_1044282408 -5 Left 1044282405 8:90371357-90371379 CCCCATTCTACAACGAAGCACAT No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282399_1044282408 27 Left 1044282399 8:90371325-90371347 CCAGTAGTCCTCCTTCAACACCC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282398_1044282408 28 Left 1044282398 8:90371324-90371346 CCCAGTAGTCCTCCTTCAACACC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282401_1044282408 16 Left 1044282401 8:90371336-90371358 CCTTCAACACCCACATTGCCTCC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282400_1044282408 19 Left 1044282400 8:90371333-90371355 CCTCCTTCAACACCCACATTGCC No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282404_1044282408 -2 Left 1044282404 8:90371354-90371376 CCTCCCCATTCTACAACGAAGCA No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data
1044282403_1044282408 6 Left 1044282403 8:90371346-90371368 CCACATTGCCTCCCCATTCTACA No data
Right 1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044282408 Original CRISPR CACATCTAGCAGCCTGACCT AGG Intergenic
No off target data available for this crispr