ID: 1044282531

View in Genome Browser
Species Human (GRCh38)
Location 8:90373194-90373216
Sequence ATGTGGCTGTGTTGGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044282523_1044282531 -2 Left 1044282523 8:90373173-90373195 CCTAACCCCCAATAATTCAAAAT No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282522_1044282531 19 Left 1044282522 8:90373152-90373174 CCAAAATTTATGTGTTGAAGTCC No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282527_1044282531 -9 Left 1044282527 8:90373180-90373202 CCCAATAATTCAAAATGTGGCTG No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282525_1044282531 -7 Left 1044282525 8:90373178-90373200 CCCCCAATAATTCAAAATGTGGC No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282528_1044282531 -10 Left 1044282528 8:90373181-90373203 CCAATAATTCAAAATGTGGCTGT No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282521_1044282531 20 Left 1044282521 8:90373151-90373173 CCCAAAATTTATGTGTTGAAGTC No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282526_1044282531 -8 Left 1044282526 8:90373179-90373201 CCCCAATAATTCAAAATGTGGCT No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data
1044282520_1044282531 21 Left 1044282520 8:90373150-90373172 CCCCAAAATTTATGTGTTGAAGT No data
Right 1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044282531 Original CRISPR ATGTGGCTGTGTTGGGAGAT AGG Intergenic
No off target data available for this crispr