ID: 1044285973

View in Genome Browser
Species Human (GRCh38)
Location 8:90412438-90412460
Sequence GACAGCTCTTGTTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044285973_1044285975 15 Left 1044285973 8:90412438-90412460 CCAGTAGCAGAACAAGAGCTGTC No data
Right 1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG No data
1044285973_1044285974 11 Left 1044285973 8:90412438-90412460 CCAGTAGCAGAACAAGAGCTGTC No data
Right 1044285974 8:90412472-90412494 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1044285973_1044285976 16 Left 1044285973 8:90412438-90412460 CCAGTAGCAGAACAAGAGCTGTC No data
Right 1044285976 8:90412477-90412499 GTTATCTGCAGAAGATGGTAGGG 0: 7
1: 193
2: 178
3: 130
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044285973 Original CRISPR GACAGCTCTTGTTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr