ID: 1044285975

View in Genome Browser
Species Human (GRCh38)
Location 8:90412476-90412498
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044285971_1044285975 22 Left 1044285971 8:90412431-90412453 CCAAAACCCAGTAGCAGAACAAG No data
Right 1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG No data
1044285973_1044285975 15 Left 1044285973 8:90412438-90412460 CCAGTAGCAGAACAAGAGCTGTC No data
Right 1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG No data
1044285972_1044285975 16 Left 1044285972 8:90412437-90412459 CCCAGTAGCAGAACAAGAGCTGT No data
Right 1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044285975 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr