ID: 1044288005

View in Genome Browser
Species Human (GRCh38)
Location 8:90431944-90431966
Sequence ATCTTTCAAAGTAATCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044288005_1044288006 -5 Left 1044288005 8:90431944-90431966 CCTCATGGATTACTTTGAAAGAT No data
Right 1044288006 8:90431962-90431984 AAGATTCAAGACTTCAGCAGAGG No data
1044288005_1044288007 17 Left 1044288005 8:90431944-90431966 CCTCATGGATTACTTTGAAAGAT No data
Right 1044288007 8:90431984-90432006 GAAGTAACTGCAGAGACGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044288005 Original CRISPR ATCTTTCAAAGTAATCCATG AGG (reversed) Intergenic
No off target data available for this crispr