ID: 1044290888

View in Genome Browser
Species Human (GRCh38)
Location 8:90468023-90468045
Sequence AGTTGACCCCTGGACATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044290888_1044290891 -7 Left 1044290888 8:90468023-90468045 CCACCAATGTCCAGGGGTCAACT No data
Right 1044290891 8:90468039-90468061 GTCAACTGTGTGTCTATGCTAGG No data
1044290888_1044290893 0 Left 1044290888 8:90468023-90468045 CCACCAATGTCCAGGGGTCAACT No data
Right 1044290893 8:90468046-90468068 GTGTGTCTATGCTAGGGCTGTGG No data
1044290888_1044290892 -6 Left 1044290888 8:90468023-90468045 CCACCAATGTCCAGGGGTCAACT No data
Right 1044290892 8:90468040-90468062 TCAACTGTGTGTCTATGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044290888 Original CRISPR AGTTGACCCCTGGACATTGG TGG (reversed) Intergenic
No off target data available for this crispr