ID: 1044301006

View in Genome Browser
Species Human (GRCh38)
Location 8:90582806-90582828
Sequence CAGCTGTTGATGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044301006_1044301010 -9 Left 1044301006 8:90582806-90582828 CCTTTTTCCCTCATCAACAGCTG No data
Right 1044301010 8:90582820-90582842 CAACAGCTGTTCAGGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044301006 Original CRISPR CAGCTGTTGATGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr