ID: 1044307671

View in Genome Browser
Species Human (GRCh38)
Location 8:90656795-90656817
Sequence AGGACTGCACAGGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044307660_1044307671 27 Left 1044307660 8:90656745-90656767 CCTCTGTGTCTCTTGGATTGGAC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG No data
1044307663_1044307671 -1 Left 1044307663 8:90656773-90656795 CCTTTGTGGTGTGTCCTTGGTTA 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG No data
1044307659_1044307671 28 Left 1044307659 8:90656744-90656766 CCCTCTGTGTCTCTTGGATTGGA 0: 1
1: 0
2: 0
3: 31
4: 303
Right 1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044307671 Original CRISPR AGGACTGCACAGGGGGTGGA AGG Intronic
No off target data available for this crispr