ID: 1044316554

View in Genome Browser
Species Human (GRCh38)
Location 8:90755950-90755972
Sequence TTCTGTATGTGGCATTACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044316554_1044316559 12 Left 1044316554 8:90755950-90755972 CCGCTGTAATGCCACATACAGAA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1044316559 8:90755985-90756007 TATAGGTCCATAAATAACCATGG No data
1044316554_1044316557 -5 Left 1044316554 8:90755950-90755972 CCGCTGTAATGCCACATACAGAA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1044316557 8:90755968-90755990 CAGAAGCCGAGGTAGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044316554 Original CRISPR TTCTGTATGTGGCATTACAG CGG (reversed) Intronic
903141838 1:21343986-21344008 GTCTGGGTGGGGCATTACAGGGG + Intronic
904032826 1:27543817-27543839 TCCTGTAGCTGGGATTACAGGGG - Intronic
904726900 1:32555795-32555817 TTATGTATGTTGGATTTCAGAGG - Intronic
909967681 1:81936535-81936557 TTCTTTATGTTGTAATACAGTGG - Intronic
910008346 1:82428826-82428848 TTCTGTTTGAGGAATTACTGGGG + Intergenic
910361253 1:86415404-86415426 TGAAGTATGTTGCATTACAGTGG + Intergenic
911075701 1:93872299-93872321 TTCTGTATGTGTTACTTCAGGGG - Intronic
915607419 1:156961475-156961497 TTCTATATGTGGAACAACAGAGG + Intronic
916124995 1:161561592-161561614 TTCTGAATGTTGCCTTCCAGTGG + Intergenic
916134887 1:161642937-161642959 TTCTGAATGTTGCCTTCCAGTGG + Intronic
916781093 1:168030339-168030361 TCCTGTATGTGGCATCTCAGAGG - Intronic
917096592 1:171404572-171404594 TTCTTTATCTGGCAATTCAGAGG - Intergenic
917294369 1:173503651-173503673 TCCTGTATGTGGCAATAGATAGG - Intronic
921422827 1:214968078-214968100 TTCTGTATGTGTCATGCTAGGGG + Intergenic
923309933 1:232725537-232725559 CTCTGTGTGGGGCAATACAGGGG - Intergenic
1063111715 10:3043985-3044007 TTCTGAATGGGGCATGAGAGAGG - Intergenic
1063710982 10:8478476-8478498 TTGAGTATCTGGGATTACAGGGG + Intergenic
1064819642 10:19312280-19312302 TTCTGTATAACACATTACAGTGG + Intronic
1066072644 10:31835766-31835788 TTCTGGATGTTTCATTACAGTGG - Intronic
1066673879 10:37867542-37867564 TTCTGTACTTTGCTTTACAGTGG + Intergenic
1067809444 10:49416020-49416042 TTCTGTATGCCTCATTTCAGAGG - Intergenic
1071065005 10:81621264-81621286 TTTTGTATATGGCAAGACAGAGG + Intergenic
1071096060 10:81976218-81976240 TTCTGTATGTGGAAAGAAAGTGG + Intronic
1073388246 10:103146932-103146954 TTCTGTATGTGTCATGTCATGGG - Intronic
1073816088 10:107209018-107209040 TTCTGTCTTTGGAATTACCGGGG - Intergenic
1074488989 10:113921879-113921901 TTCTATATTTGGCATTTCATTGG + Intergenic
1079838928 11:25369801-25369823 TTCTGCATGTGCCATTTCATTGG + Intergenic
1080282605 11:30575715-30575737 TGCTGTCTGTGGAATCACAGTGG - Intronic
1084310562 11:68313769-68313791 TTCTGTTTGTGGCAGTTTAGCGG + Intronic
1085745364 11:79110377-79110399 TGCTGTGAGTGCCATTACAGGGG - Intronic
1086892719 11:92276807-92276829 TTTGTTATGTGGCATTACTGTGG + Intergenic
1087529160 11:99356846-99356868 TTCTGTATTTGGAATTAAACTGG + Intronic
1087896015 11:103587321-103587343 TTGTGGATTTGCCATTACAGAGG + Intergenic
1089837777 11:121386517-121386539 TTTTTTATGTAGCATTACTGTGG + Intergenic
1090286110 11:125501008-125501030 TTCTGCCTGTGGAATTTCAGAGG - Intergenic
1091471821 12:735345-735367 TTTTGTAAGTGGAATTACAGGGG + Intergenic
1092514947 12:9201152-9201174 TTCTGTATTTGTCTTTCCAGAGG - Intronic
1093098935 12:15004052-15004074 CTCTGTATGTAGCTTTCCAGTGG + Intergenic
1094028599 12:25985461-25985483 TTCTGTCTATGGCAGTGCAGGGG + Intronic
1095410809 12:41919725-41919747 TTCTGTAATTGGCACTAGAGGGG - Intergenic
1102379830 12:112455207-112455229 ATCTGTAAAAGGCATTACAGAGG + Intronic
1102707167 12:114892094-114892116 TTCTGTAAGTGGCGTGACTGAGG + Intergenic
1104873803 12:132019014-132019036 TTCTGTATTTGGCTTCACTGGGG + Intronic
1107063990 13:36192479-36192501 GTCTGTTTGTGACATTCCAGTGG - Intronic
1107265526 13:38549077-38549099 TTCTGCATATGGCTTTTCAGGGG + Intergenic
1107265530 13:38549113-38549135 TTCTGCATATGGCTTTTCAGGGG + Intergenic
1108269790 13:48748483-48748505 TTCAGTCTGTTCCATTACAGTGG + Intergenic
1109112342 13:58337246-58337268 TTCTGTATGTGGCAAGAAATAGG + Intergenic
1112571690 13:100599107-100599129 TACTGTATGCAGCATCACAGTGG + Intergenic
1112918990 13:104587104-104587126 TTCTGTATGTGAAATTCCAACGG + Intergenic
1113496659 13:110735729-110735751 CCCTGTAGGTGGGATTACAGGGG + Intergenic
1118953428 14:70456766-70456788 AGCTATATGAGGCATTACAGAGG + Intronic
1120638961 14:86986609-86986631 TTGAGTATCTGGGATTACAGGGG + Intergenic
1122699985 14:103581878-103581900 TTCTGTCTGTGGGAATAAAGGGG + Intronic
1125121391 15:36162693-36162715 TTCTTTATGTAGCATTTCAGGGG + Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1135844981 16:25910729-25910751 TTTTGTAGGTGGAATTTCAGTGG - Intronic
1140832224 16:78762519-78762541 CTCTGAATTTTGCATTACAGGGG - Intronic
1141077716 16:81023162-81023184 ATCTGTATTTGTCATTAGAGGGG - Intronic
1145393515 17:22475800-22475822 TTCTGTTTGAGGGATTACACGGG - Intergenic
1147445032 17:40469836-40469858 TTCTGGGTGGGGGATTACAGGGG + Intergenic
1150000790 17:61438241-61438263 TTTTGCATGTGCCATTTCAGGGG + Intergenic
1150592782 17:66578070-66578092 TTCTGAATTTGGCATTTCAAAGG - Intronic
1151150381 17:72080196-72080218 TTCTGTATGTGGAGTTTCTGGGG - Intergenic
1152196078 17:78919215-78919237 TTCTGGCTGTGGAATGACAGCGG - Intronic
1155816834 18:30322522-30322544 TTCTTTCTGTAGCAATACAGAGG + Intergenic
1156285225 18:35686952-35686974 TTCTGTAGTTGGCATTAAACAGG + Intronic
1156373477 18:36491621-36491643 TTCTGTAAGTAGCATAACCGTGG - Intronic
1156727206 18:40143358-40143380 ATCTGTATGTGATATTACAATGG + Intergenic
1157974204 18:52307513-52307535 TTCTGTATGTGGTATAATATAGG - Intergenic
1164488274 19:28681141-28681163 TTCTGGATTTGGCTTTCCAGAGG - Intergenic
1166533277 19:43555054-43555076 TTCCATATCTGGCAATACAGCGG + Intronic
925394589 2:3523890-3523912 TTCAGTGGGTTGCATTACAGGGG + Intergenic
927488592 2:23505658-23505680 TTCTGTAGGTGGCTCTCCAGGGG - Intronic
927977707 2:27351836-27351858 GTCTGCAAGTGGCATTGCAGAGG - Intronic
929044784 2:37778755-37778777 TTCTGTCTGTGGAAGTACTGTGG + Intergenic
930419391 2:51131844-51131866 TTCTGCATGAGGCATTGCAAAGG - Intergenic
930566993 2:53033495-53033517 TTTTGTCTGTGGCAGTAGAGAGG - Intergenic
932482955 2:72059795-72059817 TTCTGTATGTGGTAAAAAAGAGG + Intergenic
936018639 2:108978144-108978166 CCCTGTACTTGGCATTACAGGGG - Intronic
939158898 2:138561918-138561940 TTATGTCCGTGGCATTACACAGG + Intronic
939175051 2:138738765-138738787 TTCTGCATGTGGCATTAACCAGG - Intronic
940012235 2:149066598-149066620 TTATGTATATGGCATAACATTGG - Intronic
941385569 2:164846877-164846899 TCCTATATTTGGAATTACAGAGG + Intergenic
942378243 2:175358937-175358959 TTCTGTATGTGGTATAACGTAGG - Intergenic
942675729 2:178424644-178424666 GTCTATGTGTGTCATTACAGGGG + Intergenic
942692597 2:178602148-178602170 AATTGTATGTGGTATTACAGAGG - Exonic
943447459 2:188005647-188005669 TTCTGTTTCTGGTAGTACAGTGG - Intergenic
945943123 2:215969562-215969584 TACAGTAGGTTGCATTACAGAGG + Intronic
1169095006 20:2889833-2889855 TCCTGAATGTGGCATCAAAGGGG + Intronic
1170718447 20:18852687-18852709 GTTTGTATGTGACATTACTGTGG + Intergenic
1174219452 20:48941686-48941708 CTCTGCATGTGGCACTTCAGTGG + Intronic
1175062582 20:56257103-56257125 TTCATTATTTGGCATAACAGGGG + Intergenic
1176520030 21:7817582-7817604 TTCAGGATGTCGCATTGCAGAGG + Exonic
1178142847 21:29703444-29703466 TTATGGATGTGGCAATAGAGAGG - Intronic
1178654058 21:34447595-34447617 TTCAGGATGTCGCATTGCAGAGG + Intergenic
1179820647 21:43935049-43935071 TTCTGTGTGTGGCATGTGAGTGG - Intronic
1179904751 21:44416733-44416755 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904757 21:44416773-44416795 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904769 21:44416851-44416873 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904795 21:44417047-44417069 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904801 21:44417087-44417109 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904813 21:44417165-44417187 TGCTATCTGTGGCATCACAGTGG + Intronic
1179904847 21:44417397-44417419 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904875 21:44417591-44417613 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904887 21:44417669-44417691 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904893 21:44417709-44417731 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904904 21:44417789-44417811 TGCTCTCTGTGGCATCACAGTGG + Intronic
1179904910 21:44417829-44417851 TGCTCTCTGTGGCATCACAGTGG + Intronic
1181666642 22:24402937-24402959 TTCTGTCTGTGGCCTTAGGGTGG - Intronic
951153663 3:19323492-19323514 TTCTTTTTGTGGCAATTCAGAGG + Intronic
952722517 3:36547828-36547850 TTTTGCATGTGGCATCAGAGAGG - Exonic
957400349 3:79704283-79704305 TTCTGTATGTGATACTACAAGGG - Intronic
960742316 3:120848286-120848308 TTCTGTATGCAGCATTATATTGG + Intergenic
961566877 3:127770318-127770340 TTCAGGGTGAGGCATTACAGTGG - Intronic
962487576 3:135860223-135860245 TTCTGGCTGTGGCATGAAAGAGG - Intergenic
965152673 3:165000658-165000680 TTCTGTGTGAGGGTTTACAGAGG - Intronic
965613870 3:170573171-170573193 TTCTGTTTGTGTCATTTCAGAGG - Intronic
966999395 3:185317856-185317878 TTTTGTAAGTGGCATTAGAATGG - Intronic
967246634 3:187493128-187493150 TTCTTTATATGGCAATTCAGAGG - Intergenic
967721895 3:192824849-192824871 TTCTATATGTGGCATAGAAGAGG - Intronic
970828292 4:20305204-20305226 TTCTGTATGTTGGGTCACAGGGG - Intronic
971337391 4:25736347-25736369 CTCAGTAGGTGGGATTACAGCGG + Intergenic
971641713 4:29142486-29142508 TTCTGTAGGTGGAATATCAGTGG + Intergenic
972174211 4:36383368-36383390 TTCTGTATGTGACATGTCTGTGG - Intergenic
975980366 4:80151265-80151287 TTATGTATGTGCCATTATAATGG + Intergenic
977800300 4:101221305-101221327 TTCTGTACATAGCACTACAGAGG - Intronic
979352130 4:119656386-119656408 TGCTGGATGTGGCAAGACAGAGG - Intergenic
979543648 4:121915392-121915414 TTTTGTATGTAGCATTTTAGGGG - Intronic
980855700 4:138436716-138436738 TTCTGTATGTCTCATTTCATGGG + Intergenic
981746893 4:148060991-148061013 TTGCGTATCTGTCATTACAGTGG + Intronic
981897528 4:149820787-149820809 TTCTGTATTTGGAATAACTGAGG - Intergenic
982219940 4:153115656-153115678 TTCTGCATGTGGCATGTCAGCGG + Intergenic
982540378 4:156662307-156662329 TTCTGTAGGAGGCATGATAGGGG - Intergenic
984149653 4:176110914-176110936 TTGTCTATGTGGCAGGACAGAGG - Intronic
985842217 5:2316168-2316190 TTCTTTATATAGCATTATAGGGG + Intergenic
987117419 5:14736723-14736745 CTCTGAATGTGGCATCCCAGGGG + Intronic
987559240 5:19496861-19496883 TTCTTTATGTGGCAGGACAGTGG - Intronic
987589257 5:19902429-19902451 TTGTGGAAGTGGCCTTACAGAGG + Intronic
988077544 5:26372246-26372268 TTCTTCCTGTGTCATTACAGGGG - Intergenic
988956012 5:36320489-36320511 TTCTGTGTGTGGCTTTATAGAGG + Intergenic
992234736 5:74697815-74697837 TTTTGTAAGTGGCATTAGAAAGG + Intronic
992759293 5:79937419-79937441 TCCTGTAGATGGGATTACAGGGG + Intergenic
996604206 5:125302204-125302226 TGCTGTATGTCACATTATAGTGG - Intergenic
997354598 5:133254279-133254301 TTCTGTATGTGGGATCCCAGAGG + Intronic
997401731 5:133608716-133608738 ATCTGTATTTAGAATTACAGAGG + Intronic
998378227 5:141705585-141705607 TTCTGTACATTGCATCACAGTGG - Intergenic
998853160 5:146370075-146370097 TTATGTAAGTGGCATCCCAGAGG + Intergenic
999138721 5:149342464-149342486 TTCTGAATGTTGCAGTACAAGGG - Intergenic
1001213372 5:169832135-169832157 TTGTGTATCTGGGATTTCAGTGG + Intronic
1003270450 6:4603221-4603243 TTCTGTATTTTGCATTTCTGCGG + Intergenic
1003363078 6:5447117-5447139 TTGGGTATCTGGCATTACTGTGG + Intronic
1004065572 6:12240651-12240673 TTCTTTATCTGGGAGTACAGGGG + Intergenic
1004424987 6:15501167-15501189 TTCTCTGTGTGGCCTTCCAGCGG - Exonic
1004715344 6:18211607-18211629 TTCTGTATGTGGCATGATTCTGG + Intronic
1005047489 6:21655863-21655885 TTCTGCAGCTGGAATTACAGAGG - Intergenic
1005216984 6:23541685-23541707 ATCTGTATGTGTCTTTAAAGTGG + Intergenic
1005521178 6:26601979-26602001 TTGCGTAGCTGGCATTACAGGGG - Intergenic
1005742859 6:28808964-28808986 TTCTGTAGCTGGGACTACAGGGG - Intergenic
1005814015 6:29536064-29536086 TTCTGTGTGTGGCAATGCAGTGG - Intergenic
1007832923 6:44652719-44652741 TTCATTATGTGCCATTCCAGAGG + Intergenic
1009814557 6:68715309-68715331 TTCTGTCTGTCTCATTATAGGGG + Intronic
1012728968 6:102856050-102856072 TTCTGTAAGTGGCAGGAAAGGGG + Intergenic
1012909635 6:105104475-105104497 TTCCCTATGTGGCCTTTCAGAGG - Intronic
1014473234 6:121841446-121841468 TTGTGTATCTGCCAATACAGTGG + Intergenic
1014735212 6:125086472-125086494 TTGTGTATGTTGCTTGACAGAGG + Exonic
1018250960 6:161869792-161869814 TCCTGTATGTGGCAGAACTGTGG - Intronic
1018412040 6:163559760-163559782 TTCTGTTTTTGGCATTACAATGG - Intronic
1021929191 7:25562588-25562610 TACTGTAATTGGCATTACAAAGG + Intergenic
1022178207 7:27893064-27893086 TTCTTTATGGGGCATCTCAGGGG - Intronic
1029889924 7:103917319-103917341 TTTTGTATGAGAAATTACAGAGG + Intronic
1030076540 7:105741768-105741790 ATCTGACTGTGTCATTACAGAGG + Intronic
1030680392 7:112427944-112427966 CACTGTATGTGTCATTACAGAGG + Intronic
1033947807 7:146743778-146743800 TTCTGTTTCTGCCATGACAGAGG - Intronic
1034312822 7:150104502-150104524 TTCAGGATGTGTCATCACAGTGG + Intergenic
1034794037 7:153996163-153996185 TTCAGGATGTGTCATCACAGTGG - Intronic
1037453652 8:19041858-19041880 TTTCCTATGTGGCTTTACAGAGG + Intronic
1038331510 8:26613216-26613238 TTCAGAATGTGAAATTACAGTGG + Intronic
1040900141 8:52410145-52410167 TTCTGTATTTGTCACTGCAGGGG - Intronic
1041690844 8:60685440-60685462 TTCTGTATGTCCCCTTACGGAGG + Intronic
1043095075 8:75957981-75958003 TTCTGTATGTGGAATAACGTGGG - Intergenic
1044316554 8:90755950-90755972 TTCTGTATGTGGCATTACAGCGG - Intronic
1044946611 8:97395499-97395521 TATTGTAGGTGGAATTACAGAGG - Intergenic
1045490439 8:102664326-102664348 TTCTGGAAGTGGGATTACAAGGG - Intergenic
1046499648 8:115059345-115059367 TTCTGTTTTTGTCATTGCAGAGG - Intergenic
1046745114 8:117868193-117868215 CTCTGTATGTGGCATCCCTGTGG + Intronic
1047167495 8:122455633-122455655 TTCAATATGAGGCATTACTGAGG + Intergenic
1047470318 8:125165000-125165022 GTCTGTATGTGGCATTACATGGG + Intronic
1047769844 8:128021859-128021881 GTATGTTTGTGGCATTACAGAGG + Intergenic
1047902555 8:129439889-129439911 TTCTGTTTGTGCCCTTCCAGGGG - Intergenic
1049732034 8:144183423-144183445 TTCTGCTTGTGGCATTATGGTGG + Intronic
1050551981 9:6757085-6757107 ATCTGTCTTTGGCAGTACAGGGG + Intronic
1051120865 9:13750670-13750692 TTCAGCATATGGCATTACAATGG + Intergenic
1051941743 9:22514561-22514583 GTCTGTCTATGGTATTACAGTGG + Intergenic
1052234810 9:26197837-26197859 TTTTGTATGTGGTATTAGTGAGG - Intergenic
1054820988 9:69520397-69520419 TTCTATATGTAGAATTACTGGGG - Intronic
1055055499 9:72020237-72020259 TTCTGTTTCTTGCATTACAGTGG + Intergenic
1056450967 9:86716447-86716469 GTCTGTACTTGGAATTACAGAGG - Intergenic
1057238501 9:93387360-93387382 TTGTGCATGTGTCAGTACAGGGG - Intergenic
1057806324 9:98222363-98222385 CTCTGTGTGTGGCTTTACATGGG - Intronic
1058628322 9:106959101-106959123 TTCTGTCTGTGGTATTACTCAGG + Intronic
1061472453 9:130837088-130837110 TTCTGTCTCTGGGATTCCAGGGG + Intronic
1186904652 X:14098342-14098364 TTCAGTATCTGGAACTACAGGGG + Intergenic
1191731861 X:64344766-64344788 TTCTCTCTGTGGAAATACAGAGG - Intronic
1193291614 X:79779630-79779652 TTCTGTGTTTGGCTTTCCAGTGG - Intergenic
1195728451 X:107940946-107940968 TTCTGTAAGTGTTATAACAGAGG + Intergenic
1197159438 X:123307223-123307245 TTCTGAAAGTGGCCTTCCAGGGG - Intronic
1198836724 X:140814016-140814038 TTCTGAATCTGGCATTTCACAGG + Intergenic
1199197699 X:145050765-145050787 TTCTGTATATGGCAGTAGATAGG - Intergenic
1200805246 Y:7427217-7427239 TGCAGTATGTGTCATTACGGAGG - Intergenic
1200900730 Y:8429323-8429345 TTCTGTATGTGGCTTTAAAATGG - Intergenic
1202259830 Y:22958844-22958866 TTCTGTCTGTAGTTTTACAGTGG + Intergenic
1202412816 Y:24592588-24592610 TTCTGTCTGTAGTTTTACAGTGG + Intergenic
1202457965 Y:25077482-25077504 TTCTGTCTGTAGTTTTACAGTGG - Intergenic