ID: 1044319982

View in Genome Browser
Species Human (GRCh38)
Location 8:90791318-90791340
Sequence GCCCGACCTTCCCCAAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044319982_1044319986 -9 Left 1044319982 8:90791318-90791340 CCCGCCTTTGGGGAAGGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1044319986 8:90791332-90791354 AGGTCGGGCAGACAGGCCACTGG 0: 1
1: 0
2: 3
3: 13
4: 160
1044319982_1044319987 -8 Left 1044319982 8:90791318-90791340 CCCGCCTTTGGGGAAGGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1044319987 8:90791333-90791355 GGTCGGGCAGACAGGCCACTGGG 0: 1
1: 0
2: 0
3: 12
4: 124
1044319982_1044319989 9 Left 1044319982 8:90791318-90791340 CCCGCCTTTGGGGAAGGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1044319989 8:90791350-90791372 ACTGGGACCAAAAGCAGAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044319982 Original CRISPR GCCCGACCTTCCCCAAAGGC GGG (reversed) Intronic
900601952 1:3506500-3506522 GCCCCACTCTCCCCAAAGTCTGG + Intronic
902233845 1:15045165-15045187 ACCCTACCTTCCCCACAGGGTGG + Intronic
903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG + Intronic
904866261 1:33581270-33581292 GCCTCACCTTCCCAAAATGCTGG - Intronic
906674922 1:47686780-47686802 GCACCTCCTTCCCCAAAGGCAGG + Intergenic
908497211 1:64706570-64706592 GCCCCAGCCTCCCCGAAGGCAGG - Intergenic
912965051 1:114229979-114230001 GCCAGTCCTTCCCCAGTGGCAGG - Intergenic
915624858 1:157108155-157108177 GTCTGATCTTCCCCAGAGGCAGG - Intergenic
919907142 1:202085800-202085822 GCCAGCCCTTCCCCAAATGTAGG - Intergenic
920051631 1:203167958-203167980 GGCCTCCCTTCCCCAGAGGCTGG - Exonic
920268735 1:204746711-204746733 GCCCTACCTTCCTCAAAGCAGGG - Intergenic
920746337 1:208632539-208632561 GCCTGAGCCTCCCCAAATGCTGG + Intergenic
920986734 1:210897701-210897723 TCCCTACATTCCCCAAAGGCAGG - Intronic
922804966 1:228380846-228380868 GACCTACCTCCCCCAAAAGCGGG - Intergenic
924534239 1:244920438-244920460 GCCCCAGCCTCCCCAAATGCTGG - Intergenic
1063187368 10:3663597-3663619 GCCTGGCCTTTCCCAGAGGCAGG - Intergenic
1063187391 10:3663691-3663713 GCCTGGCCTTTCCCAGAGGCAGG - Intergenic
1063187413 10:3663785-3663807 GCCTGGCCTTTCCCAGAGGCAGG - Intergenic
1063459082 10:6204001-6204023 CACCGACCCTCCCCAAAGCCGGG - Intronic
1076801945 10:132835006-132835028 GCCCGGCTGTCCCCACAGGCAGG - Intronic
1076820238 10:132935054-132935076 GCCCGGCCTTCCTACAAGGCTGG + Intronic
1077162052 11:1118208-1118230 GCACCACCTGCCCCAGAGGCGGG - Intergenic
1077372756 11:2191185-2191207 CCCCGACCTTCCCGCCAGGCAGG - Intergenic
1083832736 11:65243311-65243333 GCCTCAGCTTCCCCAAATGCTGG + Intergenic
1090299923 11:125626290-125626312 GCCCCACCCGTCCCAAAGGCCGG - Intronic
1096995568 12:55835902-55835924 GACCTGCCTTCCCCAAAAGCTGG + Intronic
1097022094 12:56027683-56027705 GCCCTACCTTGCCCAAGGGAAGG - Intronic
1100201877 12:92307252-92307274 GCCTGACTTTCCTCACAGGCAGG - Intergenic
1100442287 12:94628064-94628086 GCCCAACCTTCCACCAAGTCAGG - Intronic
1101001467 12:100362081-100362103 GCCCCACTTGCCCCAAAGGAAGG - Intronic
1101489125 12:105195803-105195825 GCCTCACCTTCCCAAAATGCTGG - Intronic
1102020240 12:109677315-109677337 TCCAGACCTTTCCCCAAGGCAGG - Intergenic
1102600509 12:114026167-114026189 GCCCTCCCCTCCCCGAAGGCTGG - Intergenic
1102677312 12:114667579-114667601 AGCCGACCTTCCCGACAGGCAGG + Intergenic
1103080328 12:118018725-118018747 GCCCCAGCTACCCCGAAGGCTGG - Intronic
1103944884 12:124520452-124520474 TCCAGACCTTCGCCAAAGGCTGG + Intronic
1104679237 12:130737786-130737808 GCCAGTCCCTCCCCAAGGGCAGG - Intergenic
1105638074 13:22235655-22235677 ACCCAAGCTTCTCCAAAGGCTGG + Intergenic
1105963933 13:25368282-25368304 GCCTCACCTTCCCCAAGTGCTGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1114434314 14:22691531-22691553 TCCCGACCTTGGCCAAAAGCAGG - Intergenic
1118715301 14:68555566-68555588 GCCCTGCTGTCCCCAAAGGCAGG - Intronic
1121309418 14:92927306-92927328 GCCAGACCTTAGCCAAAGGGTGG - Intronic
1124188200 15:27548335-27548357 GTCCTCCCTTCCCCAATGGCTGG - Intergenic
1124354283 15:28983794-28983816 GCCTAACCTTCCCCAGAGGTGGG - Intronic
1124896268 15:33780218-33780240 GCCAGACATTCTCCAAGGGCAGG - Exonic
1125581102 15:40786412-40786434 GCCTCACCTTCCCAAAATGCTGG - Intronic
1127831109 15:62752359-62752381 CCCACACATTCCCCAAAGGCAGG - Exonic
1128260731 15:66231227-66231249 CCCCCACCATCCCCCAAGGCAGG + Intronic
1129349914 15:74949789-74949811 ACCCTAGCTTCTCCAAAGGCAGG + Intergenic
1132588934 16:717990-718012 GCCCATTCTTCCCCAAGGGCGGG - Exonic
1132984596 16:2758123-2758145 GCCTGAGCTTCCCAAAATGCTGG - Intronic
1136242248 16:28951461-28951483 GCCCTACCCTCCCCGAACGCCGG - Intronic
1136531584 16:30873597-30873619 GCCCCAGCCTCCCCAAATGCTGG - Intronic
1137673203 16:50291316-50291338 GCCCCACCATCCCCACCGGCTGG - Intronic
1138450921 16:57093004-57093026 GCCCGCCCTTCCCCGCAGTCCGG - Intronic
1138699963 16:58852183-58852205 GCCTGAGCTTCCCAAAATGCTGG - Intergenic
1139853193 16:69962722-69962744 TCCCCACCATCCCCACAGGCTGG + Intronic
1139882164 16:70185630-70185652 TCCCCACCATCCCCACAGGCTGG + Intronic
1140370344 16:74409874-74409896 TCCCCACCATCCCCACAGGCTGG - Exonic
1140485534 16:75290239-75290261 GCCTGACCATCCCCATGGGCTGG - Intergenic
1142438386 16:90077516-90077538 GCGGGACCTTCCCCAGGGGCGGG - Intronic
1142438395 16:90077534-90077556 GCAGGACCTTCCCCAGGGGCGGG - Intronic
1142807513 17:2379299-2379321 GGGGGCCCTTCCCCAAAGGCCGG + Intronic
1143531923 17:7510168-7510190 GCCCAACCTGCCCCCAAGTCTGG - Intronic
1144670689 17:17131096-17131118 GCCCAGCCTTCCTCAAAGCCAGG + Intronic
1144800286 17:17921586-17921608 GCCCCCTCTTCCCCAAAGCCTGG - Intronic
1144954416 17:19011867-19011889 ACCCGCCCTTCCCCATGGGCTGG + Intronic
1145813164 17:27777071-27777093 GCCAGCCCTTCCCCAAACACCGG + Intronic
1146667543 17:34715174-34715196 CCCTGACCTGCCCCAGAGGCTGG + Intergenic
1147175441 17:38653316-38653338 GCCCCAGCTTCCCAAAATGCTGG + Intergenic
1150479234 17:65496852-65496874 GCTGGACCTTCCAGAAAGGCAGG + Intergenic
1151773649 17:76182377-76182399 GCCAGACCATGCCCAAATGCAGG + Intronic
1152574790 17:81135263-81135285 GACCGAGCTTCCTCAAAGCCTGG - Intronic
1152644854 17:81464020-81464042 GCCCGACCCTCCGCAGAGGATGG - Exonic
1153602597 18:6796012-6796034 GCCAGACTTTGCTCAAAGGCAGG - Intronic
1154284158 18:13036029-13036051 GCCTCAGCTTCCCCAAAAGCTGG - Intronic
1158484250 18:57850800-57850822 GCCCCAGCTTCCCAAAATGCTGG + Intergenic
1160388435 18:78512285-78512307 ACCCCTCCTTCCCCAGAGGCAGG + Intergenic
1160791380 19:925311-925333 GCCCGTCCCTCCCCAGAGGGAGG + Intergenic
1163214380 19:15864825-15864847 GCCCAAACTTCCCCCCAGGCTGG - Intergenic
1163632586 19:18424940-18424962 GCCTGACCTTCCCCAAACTTGGG - Intronic
1163746693 19:19052902-19052924 TCCCGACCTTCTGCAAAGTCAGG + Intronic
1165230091 19:34381342-34381364 GCCTCACCTTCCCCAGAGCCAGG - Intronic
1165710075 19:38004746-38004768 GCCCGCCCTTCCTCTATGGCAGG - Intronic
1167848492 19:52183907-52183929 GCCCGAGCTTCCCGAATAGCTGG - Intergenic
925420102 2:3704254-3704276 GCCCGCCCTGCCCCATAGGAAGG - Intronic
926217074 2:10912284-10912306 GACCGCCCTTCCCCGCAGGCGGG + Exonic
927453916 2:23232873-23232895 GCCTGAACTCCTCCAAAGGCAGG - Intergenic
927458716 2:23279061-23279083 GGCCAACCTTCCCCAAATGAGGG + Intergenic
929984706 2:46716723-46716745 GCCCCAGCCTCCCCAAATGCTGG + Intronic
931521858 2:63106422-63106444 GCCCCACTTTCCCCAGTGGCAGG - Intergenic
935165090 2:100563151-100563173 GCCGGAGCTTCCCCCAGGGCGGG - Intronic
938099129 2:128486281-128486303 GCCCGACCTCCCCCATAGCATGG + Intergenic
938155813 2:128939183-128939205 GCCCAACCTTCACCAGAGCCTGG - Intergenic
942222722 2:173787265-173787287 GCCCTACCTTCCCCAAAAGTAGG + Intergenic
1171013385 20:21520843-21520865 GCCCGACCTTCCCCGGATGAGGG + Intergenic
1172331259 20:34077457-34077479 GGCAGACCTCCCCCAAATGCGGG + Intronic
1174822480 20:53738734-53738756 GCCCGCCCGCCCCGAAAGGCAGG - Intergenic
1176267459 20:64217688-64217710 GTCTGACCCTCCCCAGAGGCAGG - Intronic
1180174879 21:46082628-46082650 TCCCGACCTGTCCCACAGGCTGG + Intergenic
949533482 3:4978790-4978812 CCCCAGCCTTCCCCAGAGGCTGG - Intergenic
950230395 3:11271059-11271081 CCCCCACCCTCCCCAAAGGCAGG - Intergenic
950743204 3:15065823-15065845 GCCTCGGCTTCCCCAAAGGCTGG - Intergenic
951715074 3:25633536-25633558 GCCCCACCTTCCCCAACCTCTGG - Intronic
953727686 3:45414854-45414876 GTCAGTCCTTCCCCACAGGCAGG + Intronic
953982940 3:47421773-47421795 GCCCGTCTTTCCCCCAGGGCTGG - Intronic
968760001 4:2437706-2437728 GCCCGAGTTTCCGCCAAGGCAGG - Intronic
969874336 4:10124715-10124737 GTCCCACGGTCCCCAAAGGCGGG - Intergenic
972952466 4:44344433-44344455 GCCTTAGCTTCCCCAAATGCTGG + Intronic
976620396 4:87121105-87121127 GCCTCACCTTCCACAAAGGGAGG - Intronic
977250858 4:94687234-94687256 GCCTGAACTTGCCCTAAGGCAGG + Intergenic
981577941 4:146224562-146224584 GCCAAACCTTCACCAGAGGCTGG + Exonic
982200727 4:152957536-152957558 GCCCTTCCTTCCTCCAAGGCAGG - Intronic
983178815 4:164623366-164623388 GCCCCACTCTCCCCAATGGCAGG + Intergenic
984811171 4:183797584-183797606 GCGCGACCGTCCCCCAGGGCAGG - Intergenic
989219065 5:38934752-38934774 GCCTCAGCTTCCCCAAGGGCTGG + Exonic
993674833 5:90804285-90804307 GCCTCACCTTCCCCAATAGCTGG - Intronic
999149439 5:149417067-149417089 GCCCTATCTTCCCCAAGGGTAGG + Intergenic
1005247197 6:23900749-23900771 GTCTTACCTTCCCCCAAGGCTGG - Intergenic
1006826670 6:36940843-36940865 GCCTGAGCTTCCCAAATGGCTGG - Intergenic
1007196973 6:40070697-40070719 GCCTCACTTTCCCCAAAAGCAGG + Intergenic
1008976930 6:57437904-57437926 GCCTTAGCTTCCCCAAATGCTGG + Intronic
1009165068 6:60330850-60330872 GCCTTAGCTTCCCCAAATGCTGG + Intergenic
1014158394 6:118138012-118138034 GCCTGACCCTCCCCTAAGGTTGG - Intronic
1014219211 6:118783093-118783115 CCCAGTCCTCCCCCAAAGGCTGG + Intergenic
1014866525 6:126538175-126538197 TCCCCACCCTCCCCCAAGGCAGG + Intergenic
1017995448 6:159528063-159528085 GTCCGACTTCCCCCAAGGGCAGG + Intergenic
1019479737 7:1261080-1261102 GCCTGACCTTCCCCAAGGCCTGG - Intergenic
1020077874 7:5270495-5270517 GCCCTACCTCCCCCCAGGGCGGG + Intergenic
1020766795 7:12332033-12332055 TCCCTACCTTCCCCAAAGGAGGG - Intronic
1022619815 7:31971654-31971676 GCCAGAGCTTCCTCATAGGCAGG + Intronic
1025201013 7:56961675-56961697 GCCCTACCTCCCCCCAGGGCGGG - Intergenic
1025670930 7:63615257-63615279 GCCCTACCTCCCCCCAGGGCGGG + Intergenic
1026167395 7:67922481-67922503 GCCTCAGCTTCCCCAAATGCGGG - Intergenic
1027471684 7:78581988-78582010 TCCTGACCTTCCCCTAAAGCAGG - Intronic
1029252724 7:99248632-99248654 GCCTCAGCTTCCCCAAATGCTGG + Intergenic
1031964034 7:128014520-128014542 GGCCTCCCTTTCCCAAAGGCGGG + Intronic
1033672998 7:143511197-143511219 GCCTGCGCTGCCCCAAAGGCCGG - Intergenic
1039546583 8:38415094-38415116 TCCCTTCCTTCCCCAAAGACTGG + Intronic
1041944151 8:63423151-63423173 ACCGGAACTTCCCCAAGGGCAGG + Intergenic
1042564225 8:70096644-70096666 GCCTCAGCTTCCCCAAATGCTGG + Intergenic
1042870510 8:73393842-73393864 GCCTCAGCTTCCCCAAGGGCTGG + Intergenic
1043482565 8:80668191-80668213 GCCCAGCCATCCCCAAAGCCAGG - Intronic
1044319982 8:90791318-90791340 GCCCGACCTTCCCCAAAGGCGGG - Intronic
1049369018 8:142254650-142254672 GCCCCGCCTTCCCCATATGCCGG - Intronic
1049791009 8:144472755-144472777 GCCCGGCCTTCCCCCATGTCGGG + Intronic
1053405420 9:37871182-37871204 CCCCCACCTTCCCCAATAGCTGG - Intronic
1056688504 9:88786208-88786230 GCTCAACCTGCCCCAAAGGGTGG + Intergenic
1057169292 9:92951133-92951155 GCCCCACATTCCTTAAAGGCCGG - Intronic
1057364525 9:94406486-94406508 GCCCCAGCTTCCCAAAATGCTGG + Intronic
1059767287 9:117395510-117395532 GCCCAACCGTCCCTAAAGGTAGG + Intronic
1061974804 9:134062696-134062718 GCCCGACCCTCCACACATGCTGG + Intronic
1062277392 9:135737298-135737320 GCCCAACCATCCCCAGAGGACGG - Intronic
1192868386 X:75160776-75160798 GCCTCAGCTTCCCCAATGGCTGG + Intergenic
1193450416 X:81658324-81658346 GCCCCACCTTCTCCATTGGCAGG - Intergenic
1196893446 X:120311159-120311181 GCCCCAGCTGCCCCAAAAGCCGG - Intronic
1197942285 X:131802825-131802847 ACCAGACCTTCCCCAACAGCTGG + Intergenic
1200115561 X:153768323-153768345 GCCCGAGCTTCAGCAGAGGCTGG - Exonic
1201532286 Y:15005206-15005228 GCACACCATTCCCCAAAGGCTGG + Intergenic