ID: 1044321942

View in Genome Browser
Species Human (GRCh38)
Location 8:90811973-90811995
Sequence AGCTGCACCTCAAATAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044321940_1044321942 -1 Left 1044321940 8:90811951-90811973 CCCAGAGATGATGGGTGCATAAA 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1044321942 8:90811973-90811995 AGCTGCACCTCAAATAGAGTTGG No data
1044321939_1044321942 0 Left 1044321939 8:90811950-90811972 CCCCAGAGATGATGGGTGCATAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1044321942 8:90811973-90811995 AGCTGCACCTCAAATAGAGTTGG No data
1044321938_1044321942 1 Left 1044321938 8:90811949-90811971 CCCCCAGAGATGATGGGTGCATA 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1044321942 8:90811973-90811995 AGCTGCACCTCAAATAGAGTTGG No data
1044321941_1044321942 -2 Left 1044321941 8:90811952-90811974 CCAGAGATGATGGGTGCATAAAG 0: 1
1: 0
2: 2
3: 9
4: 103
Right 1044321942 8:90811973-90811995 AGCTGCACCTCAAATAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044321942 Original CRISPR AGCTGCACCTCAAATAGAGT TGG Intronic
No off target data available for this crispr