ID: 1044323048

View in Genome Browser
Species Human (GRCh38)
Location 8:90827247-90827269
Sequence TGATTAAATTAGAGTGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044323048_1044323055 20 Left 1044323048 8:90827247-90827269 CCCTGACCACTCTAATTTAATCA 0: 1
1: 0
2: 0
3: 20
4: 199
Right 1044323055 8:90827290-90827312 GGAGTCAGTCATACATAACCTGG No data
1044323048_1044323052 -1 Left 1044323048 8:90827247-90827269 CCCTGACCACTCTAATTTAATCA 0: 1
1: 0
2: 0
3: 20
4: 199
Right 1044323052 8:90827269-90827291 AAGAGTACAGCCTGGCCTGAAGG No data
1044323048_1044323051 -9 Left 1044323048 8:90827247-90827269 CCCTGACCACTCTAATTTAATCA 0: 1
1: 0
2: 0
3: 20
4: 199
Right 1044323051 8:90827261-90827283 ATTTAATCAAGAGTACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044323048 Original CRISPR TGATTAAATTAGAGTGGTCA GGG (reversed) Intronic
900491867 1:2953435-2953457 AGCTTGAATTAGAGTGGACAAGG + Intergenic
904980577 1:34497538-34497560 TGATTAGCTTAGGCTGGTCATGG - Intergenic
907619786 1:55965269-55965291 GGATTGAATTAGAGTGGCTATGG + Intergenic
908251550 1:62269923-62269945 TAATTAAACCAGAGTGTTCAGGG + Intronic
908257338 1:62313946-62313968 TGAATATAATAGTGTGGTCAGGG - Intronic
911518819 1:98903913-98903935 TTATAAGATTACAGTGGTCATGG - Intronic
911522749 1:98948088-98948110 TGATTTCATGAGACTGGTCAGGG - Intronic
912061510 1:105677274-105677296 TGGTTAAATTAGAGTAAACATGG - Intergenic
915672088 1:157498247-157498269 TGATAAAATTAGCAAGGTCATGG - Intergenic
916913263 1:169375694-169375716 TGATGAACTCTGAGTGGTCACGG - Intronic
917076078 1:171206607-171206629 TGATTAAGTAAGACTGGCCAAGG + Intronic
917092440 1:171366967-171366989 AAATTAATTGAGAGTGGTCAAGG - Intergenic
917742383 1:177973221-177973243 TCATTAAATCACAGTGCTCAAGG - Intronic
918326426 1:183415472-183415494 TCATGAAAATAGAGTGTTCATGG + Intronic
918915349 1:190629083-190629105 TCATTACATTGGAGTGGGCAAGG - Intergenic
919017650 1:192060777-192060799 TGATTAACTTAGAATAGTCTTGG + Intergenic
1066181477 10:32965578-32965600 TGATTAAAATATAGTAGGCAAGG - Intronic
1067808283 10:49408149-49408171 TGAATAAATTAGTGGGGACAAGG + Intergenic
1072238565 10:93474099-93474121 TGATTAAATTAAAGTGATAAGGG - Intronic
1073167031 10:101464507-101464529 TTGTTAAATTAAAGTGGGCAGGG - Intronic
1074578525 10:114693951-114693973 TGATTAAAATAGACTGGGCATGG - Intergenic
1075908652 10:126104827-126104849 TTATTAAGTTAGAATGGTCCAGG + Intronic
1076303618 10:129447467-129447489 AATTTAAAGTAGAGTGGTCAAGG + Intergenic
1078057896 11:8022064-8022086 TGATTCAGTTAGTTTGGTCAAGG - Intronic
1080878744 11:36300043-36300065 TGATTAAATTATAGTGGGGCAGG - Intronic
1081261648 11:40969248-40969270 TGATAAAATTTGAATGGTTAGGG + Intronic
1081996974 11:47372025-47372047 TGCTTTCATTTGAGTGGTCAGGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1082881145 11:58039502-58039524 TGATTAAATGAAAGTGCTCCTGG - Intronic
1083377679 11:62239151-62239173 TGATCAAATGAGTGTGTTCATGG - Intergenic
1083384932 11:62300627-62300649 TGATCAAATGAGTGTGTTCATGG + Intergenic
1084451080 11:69239053-69239075 TATTCAAATTAGATTGGTCAGGG + Intergenic
1084718112 11:70886409-70886431 TCATTAGATCAGAGTGGTCGGGG - Intronic
1088177049 11:107065555-107065577 TTATTTAATAAGAGTGATCATGG - Intergenic
1089367115 11:117927670-117927692 TGATTAAATAGGAGTGGTCTGGG - Intronic
1089974315 11:122719103-122719125 TGATTACGTTAGATTGGTGATGG + Intronic
1090888473 11:130900564-130900586 TGAATAACTCAGAGTGCTCAAGG - Intronic
1092071580 12:5635822-5635844 AAAGTAAATTTGAGTGGTCAGGG + Intronic
1092361353 12:7839217-7839239 AGATTAAGATAGAGTGGTTAGGG + Intronic
1092375796 12:7954481-7954503 AGATTAAGATAGAGTGGTTAGGG + Intergenic
1093551405 12:20416186-20416208 ATATGAAATTGGAGTGGTCATGG + Intronic
1095164190 12:38952459-38952481 TGATTTAATCACAGTGGCCAGGG + Intergenic
1095264672 12:40140671-40140693 TGATAAAATTTGAGTTTTCAAGG + Intergenic
1095403719 12:41844201-41844223 TGATTAAGATACAGTGCTCAAGG - Intergenic
1095711272 12:45290906-45290928 TGATCAAAATAGTGTGGTCTTGG + Intronic
1098189347 12:67931527-67931549 TGTTTTAAATACAGTGGTCAGGG - Intergenic
1099305058 12:80943595-80943617 AGGTTACTTTAGAGTGGTCAGGG + Intronic
1100138426 12:91585378-91585400 TGATGGAATTTGAGTGGTAATGG - Intergenic
1100509242 12:95253192-95253214 TGATTAAACTAGAATGCTCAAGG - Intronic
1100871506 12:98914823-98914845 TATTTCAAATAGAGTGGTCAAGG - Intronic
1105687750 13:22802974-22802996 TGATTAAATGAGAAAGGTAAGGG + Intergenic
1106345344 13:28871756-28871778 GGATTACTTTAGAGTGGTTAAGG + Intronic
1106691177 13:32118688-32118710 TTCTGAAATTAGAGTGGTAATGG - Intronic
1107921313 13:45211189-45211211 GGATTAAATTATAATGGACACGG - Intronic
1109412833 13:61995889-61995911 TCTTTTAATTAAAGTGGTCATGG - Intergenic
1110951550 13:81499070-81499092 TGATGAAATTTGAGTAGTCCTGG + Intergenic
1111190500 13:84800600-84800622 TAATTAAAGTAGAGGGCTCAAGG - Intergenic
1111958932 13:94788430-94788452 TTAGGAAATTAGACTGGTCAAGG + Intergenic
1114682896 14:24501812-24501834 TGGTCAGAGTAGAGTGGTCATGG + Intronic
1115697055 14:35910383-35910405 TGGTTAAAGTAGAGCGGTTATGG + Intronic
1115809018 14:37085202-37085224 TGTTTTAAATAGAGTGGTTAGGG - Intronic
1115976340 14:39001174-39001196 TGATCAAATTAATTTGGTCAAGG + Intergenic
1120199683 14:81523401-81523423 TGATCAGATCAGAGTGGGCATGG + Intronic
1121367557 14:93328375-93328397 TAATTAAAATAGAGTGGTATTGG + Intronic
1126915003 15:53456745-53456767 TTATTAAATTGGAGTGTTAATGG + Intergenic
1127180386 15:56409846-56409868 TATTTAAAATAAAGTGGTCAGGG - Intronic
1128174233 15:65540432-65540454 TATTTTAAATAGAGTGGTCAGGG + Intronic
1128687265 15:69696033-69696055 TAATTTAATTAGAGTGGTCCAGG - Intergenic
1129145456 15:73642833-73642855 TGATTTAATTGGTGTGGTCTAGG - Intergenic
1129508433 15:76102388-76102410 TATTTTAATTAGGGTGGTCAGGG + Intronic
1130387747 15:83426914-83426936 TGATAAAATTAGTCTGGGCACGG + Intergenic
1137318960 16:47358971-47358993 AGTTTTAAATAGAGTGGTCAGGG + Intronic
1137492178 16:48942461-48942483 TGATACAATAAGAGTGGGCAGGG - Intergenic
1138025096 16:53515970-53515992 TGAATAAATGAGACAGGTCATGG - Intergenic
1144472888 17:15560361-15560383 TGTTAAAAATACAGTGGTCATGG - Intronic
1144923594 17:18784345-18784367 TGTTAAAAATACAGTGGTCATGG + Intronic
1147021153 17:37534231-37534253 TGATGAAATTAGGCTGGGCATGG - Intronic
1147675980 17:42205956-42205978 TTATTTTACTAGAGTGGTCAAGG - Intronic
1150645950 17:66977600-66977622 CGATTAAATGAGATTGGACATGG + Intronic
1151375455 17:73685577-73685599 TCATTTAAATAGTGTGGTCAGGG + Intergenic
1153746691 18:8186901-8186923 AGATTGACTTAGAGTGGGCAAGG + Intronic
1156232595 18:35168997-35169019 TGATTAAATCAGAATCTTCATGG - Intergenic
1158708459 18:59816265-59816287 TAAATAGAATAGAGTGGTCAGGG + Intergenic
1159177823 18:64861477-64861499 TGACTAAATTAGATAGGTAATGG - Intergenic
1164660446 19:29961148-29961170 TGATTAAAATGGGCTGGTCATGG - Intronic
1167692974 19:50998286-50998308 TTTTTTAATTCGAGTGGTCAGGG - Intronic
1168370866 19:55832859-55832881 TGTTGAAATAAGAGTGGTGACGG - Intronic
926582522 2:14646836-14646858 TGTTTTAATGAGAATGGTCATGG - Intronic
927264673 2:21132000-21132022 AGTTTTAATTAGAGTAGTCAGGG + Intronic
929104154 2:38347467-38347489 TGATTTAGATTGAGTGGTCAGGG - Intronic
929723348 2:44395528-44395550 TTTTTAATTTAGAGTGGTTATGG + Intronic
930341550 2:50122399-50122421 TGAGTTAATTAGAGTAGTCAAGG - Intronic
930687700 2:54326739-54326761 TATTTTAAATAGAGTGGTCATGG - Intergenic
931465489 2:62483181-62483203 TGACTAAATTAGCATGGTTATGG - Intergenic
932057246 2:68458546-68458568 AGATGAAGTTAAAGTGGTCAGGG + Intergenic
935599417 2:104907315-104907337 TGTTGGAATTAGAGAGGTCAGGG - Intergenic
938297824 2:130189414-130189436 TGATTAGGTCAGAGTAGTCAAGG + Intronic
938458941 2:131485254-131485276 TGATTAGGTCAGAGTGGTCAAGG - Intronic
938648944 2:133360866-133360888 TAATCAAATTAGAGTGGAGAAGG + Intronic
939501007 2:142984362-142984384 TGATAAAATTAGAGTTTCCAGGG - Intronic
941972730 2:171369775-171369797 TTATTCAATTAGGCTGGTCACGG + Intronic
942218434 2:173745765-173745787 TGATAAAACTAGAGTGGGCCAGG + Intergenic
942241680 2:173968041-173968063 TGATCAAATCAGAGTGTTTAGGG - Intergenic
942964928 2:181880619-181880641 TGATTGAACTAGTGTAGTCAGGG - Intergenic
943651956 2:190467011-190467033 GGATTGAATTACAGTTGTCATGG + Intronic
944904601 2:204250165-204250187 CGATTTAAGTTGAGTGGTCAGGG - Intergenic
946541886 2:220693834-220693856 TGATTAATAGAGAGTGGCCAGGG + Intergenic
946813019 2:223546668-223546690 TAATTAAAACAGAGTGGTCCTGG + Intergenic
1168942697 20:1726967-1726989 TGATTATATTGGAGTCATCAGGG + Intergenic
1169638743 20:7724508-7724530 TGTTTTAACTAGAGTGGTCAGGG + Intergenic
1171117825 20:22541661-22541683 TGATAAAATCAGAATGCTCATGG + Intergenic
1172432284 20:34902419-34902441 TGATCTACTTAGGGTGGTCAGGG + Intronic
1173462627 20:43255766-43255788 TTCTGAAATTAGAGTGGTGATGG + Intergenic
1173671930 20:44804997-44805019 TGATTAAAATAAAGTGGTCTGGG + Intronic
1173964685 20:47103186-47103208 TTCTAAAATTAGAGTGGTGATGG - Intronic
1181081011 22:20415047-20415069 TGATTAAAGTAGGCTGGGCATGG - Intergenic
949244633 3:1912128-1912150 TAATTTATGTAGAGTGGTCAAGG - Intergenic
950129766 3:10534053-10534075 TGGTTAAATGAGAGGTGTCAGGG + Intronic
950572558 3:13810764-13810786 TTACTAAATTAGGGTGATCAGGG + Intergenic
951111215 3:18806681-18806703 ACATTAAGTTAGAGTGGTCAGGG + Intergenic
951187383 3:19729833-19729855 TAATTAAATGAGAGGAGTCATGG - Intergenic
952208192 3:31201529-31201551 TGATTAAAGTATAGTTGTAAGGG - Intergenic
952685583 3:36144301-36144323 TGATAAAATTAGAGTAGGCATGG - Intergenic
953704816 3:45223238-45223260 TGATTACATTAAATTGATCAAGG + Intergenic
954095915 3:48327633-48327655 TGATTAAATTGGAGAGGGAAGGG + Intronic
955017287 3:55084382-55084404 AGATTAAATTAGAGTTGAAAAGG + Intergenic
956516026 3:70049159-70049181 TGATTAAATTTGTGTCCTCAAGG + Intergenic
958021842 3:88006870-88006892 TGTTTTAGTTAGGGTGGTCAGGG - Intergenic
958121874 3:89300993-89301015 CATTTAATTTAGAGTGGTCAGGG - Intronic
958581016 3:96023532-96023554 TGACAAAATCAGAGTGGTAATGG - Intergenic
958975104 3:100658675-100658697 TATTTTAAATAGAGTGGTCAGGG - Intronic
960513408 3:118577041-118577063 TGAATAAAGTAAAGTGGTTAAGG - Intergenic
961003098 3:123387075-123387097 TGATTAAATTACCGGGTTCAAGG + Intronic
961398220 3:126613176-126613198 TGATTAAATAAAAGAGGTGAAGG - Intronic
962018820 3:131474587-131474609 TGATCAAATTAGGGTAGTTACGG - Intronic
964506214 3:157402659-157402681 TGAGTAAATGAAAGTGGTCTGGG - Intronic
964528827 3:157645103-157645125 TGAGCAGATAAGAGTGGTCAGGG + Intronic
967756711 3:193178376-193178398 TGCTTATAGTAGAGTAGTCAGGG - Intergenic
969280031 4:6163797-6163819 GGAGAAAATTGGAGTGGTCAGGG + Intronic
970568452 4:17355452-17355474 TGATTGAAATTGAGTGTTCAAGG + Intergenic
971060964 4:22969084-22969106 TGTTTAAAATAAAGTGGGCAAGG + Intergenic
971736261 4:30456347-30456369 TGATTAAATTGGACTTGTGAAGG - Intergenic
972401516 4:38708586-38708608 TAATTAAAATAGTGTGGTCTTGG - Intergenic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
973804681 4:54514219-54514241 TGATTAAATAAGATGGGGCAAGG + Intergenic
976223897 4:82780278-82780300 TGACTAGAGGAGAGTGGTCAAGG - Intronic
976531261 4:86155066-86155088 TGATTAAATCAGAGTGCGGATGG + Intronic
976926752 4:90507679-90507701 TGATTAAAAAAGAATGGTAATGG - Intronic
978003741 4:103590906-103590928 TGAAGAAATCACAGTGGTCAAGG - Intronic
978174697 4:105716272-105716294 TGATTTAAATTGAGTAGTCAGGG + Intronic
978983278 4:114978786-114978808 GGATGAAATTGGAGTGGTGAGGG - Intronic
980338703 4:131512169-131512191 TGATTATAATATAGTTGTCAAGG + Intergenic
982846149 4:160254878-160254900 TAATTAAATTGGAGTGCTAAAGG - Intergenic
984416178 4:179460663-179460685 TGTTCAAATTAGAGTTGCCATGG + Intergenic
986476628 5:8140841-8140863 TAATTAAAATAGAGTGGGCTGGG - Intergenic
987047506 5:14121695-14121717 TCATTAAATTATAGTGTTCTGGG + Intergenic
987461020 5:18210266-18210288 TGATTACATAAAAGTGGACAAGG + Intergenic
987976841 5:25025379-25025401 TGATTTCTTTAGAGTGGTGAAGG + Intergenic
988127994 5:27067553-27067575 TCATGAAATTACAGAGGTCAAGG - Intronic
990289417 5:54333638-54333660 AGAATAAATCAGAGTAGTCAGGG + Intergenic
994409772 5:99392396-99392418 TCATTAAATAAGACTGGTCAAGG - Intergenic
994484048 5:100372884-100372906 TCATTAAATAAGACTGGTCAAGG + Intergenic
994529272 5:100946831-100946853 TGGCTATATAAGAGTGGTCAAGG - Intergenic
994839389 5:104903221-104903243 TAATTAAATTATAGTAATCATGG - Intergenic
995195789 5:109366524-109366546 TGAAGATATTAAAGTGGTCAGGG - Intronic
996312629 5:122123922-122123944 GGTTTAAATTAGAGTGTTCATGG - Intergenic
998865278 5:146493362-146493384 TGATTAAATTGAAGTGGTGAAGG + Intronic
999112736 5:149136322-149136344 TGATTTAGCTAGACTGGTCATGG + Intergenic
1001729082 5:173935444-173935466 TGAATAGATTACAGTGGACAAGG - Intronic
1005209172 6:23440999-23441021 TAATAAAAATAGGGTGGTCAAGG - Intergenic
1005232142 6:23714706-23714728 TGATCAAATCAGGATGGTCATGG - Intergenic
1007143783 6:39606363-39606385 TGATTAAATCAGAGAGCACAGGG - Intronic
1007651699 6:43426645-43426667 TAATTAATTTAGAGTGCTTAGGG - Intergenic
1010942068 6:81930884-81930906 TGATTTAATTAGAGTTGTACTGG - Intergenic
1011428867 6:87263459-87263481 TGAATAAATAAGCATGGTCAAGG + Exonic
1012359973 6:98365370-98365392 GGATTAAATTAGACTAGCCATGG + Intergenic
1014966727 6:127762659-127762681 TTAATTAATTAGAGTGGCCAGGG - Intronic
1016713614 6:147200299-147200321 TGATTAAAATAGAGTTGCCCAGG + Intergenic
1017807226 6:157956186-157956208 TCACTAAATTAGAGTGGTACAGG - Intergenic
1017928806 6:158934865-158934887 TCATTAAATTTGAGGGATCAAGG - Intergenic
1018549070 6:164973223-164973245 TGTTCAAATTAGAGTGATAAAGG - Intergenic
1023106760 7:36770528-36770550 TGATTATATTAGAATGCTCAGGG + Intergenic
1023694379 7:42829693-42829715 TGATTGATTTGGGGTGGTCATGG + Intergenic
1024692950 7:51822721-51822743 TGCCTAACTTAAAGTGGTCAAGG - Intergenic
1030378093 7:108777025-108777047 TGATTGAATGAGAGTGGTCCTGG - Intergenic
1035392548 7:158514979-158515001 AGATAAAATAAGAGTGGTCACGG - Intronic
1037275484 8:17173597-17173619 TGATTAAATCTGGGTGGTCGAGG + Intronic
1037275531 8:17174170-17174192 TGATTAAATCTGGGTGGTCGAGG - Intronic
1037672309 8:21025652-21025674 AAATTAAAATAGAGTGGTCAGGG + Intergenic
1038965957 8:32572608-32572630 TGTTTAAATTTGAGAGGTTATGG - Intronic
1041759357 8:61347328-61347350 TGACTGAATTAGAGAGGTGATGG + Intronic
1042882089 8:73504846-73504868 TGATTAACTTAGAGAATTCAAGG + Intronic
1044323048 8:90827247-90827269 TGATTAAATTAGAGTGGTCAGGG - Intronic
1044377130 8:91488713-91488735 CTATTTAGTTAGAGTGGTCAGGG + Intergenic
1045762307 8:105625049-105625071 TCATTAAATTAGAGTTTTCTTGG - Intronic
1046095323 8:109552235-109552257 TGCTAAAAGTAGAGTGGTCTGGG + Intronic
1047866335 8:129028203-129028225 TGATTCAAGTTGACTGGTCAGGG - Intergenic
1048184143 8:132223773-132223795 AGACTAAATTAGAGAGGTCATGG + Intronic
1048238626 8:132718148-132718170 TTATAGAATTAGAGTGGTGATGG + Intronic
1048641982 8:136373695-136373717 TGATTAAAATAAAGTGGACGAGG + Intergenic
1050742239 9:8835430-8835452 TGCTTTAATTAATGTGGTCAAGG - Intronic
1052042504 9:23755097-23755119 TTATAAAACTAAAGTGGTCAGGG - Intronic
1052859958 9:33431540-33431562 TGATTATATCAGCTTGGTCATGG - Intergenic
1054568180 9:66781464-66781486 TAATTTAGTTTGAGTGGTCAGGG - Intergenic
1054916683 9:70500966-70500988 GGATTTAATCAGAGTTGTCAAGG + Intergenic
1054964723 9:71010154-71010176 TCATGAAATTGGACTGGTCAAGG + Intronic
1055273812 9:74591514-74591536 ACATTAAATTAGAGTGTTTATGG - Intronic
1058041978 9:100312630-100312652 AGATTATATTAGAGTAGTTATGG - Intronic
1059775444 9:117470050-117470072 GAATTAAATAACAGTGGTCATGG + Intergenic
1061650559 9:132045517-132045539 TGGTTATATTTGAGTGGTAAAGG + Intronic
1186833550 X:13415206-13415228 GTATTAAATTACAGTGCTCAAGG - Intergenic
1190145375 X:47886680-47886702 TGATTAAACCTGAGAGGTCAAGG - Intronic
1191587064 X:62839321-62839343 TGATAAAATTAGACTAGTCTAGG - Intergenic
1191699435 X:64023754-64023776 TGACTAAAGGAGAGTGCTCAGGG - Intergenic
1194726652 X:97406147-97406169 TGATCTAATTAGAATGGCCAGGG - Intronic
1197379251 X:125719105-125719127 TGAATAAAAAAGAGTGATCATGG + Intergenic
1197658818 X:129148097-129148119 TGCTTAAATCAGGGAGGTCAAGG - Intergenic
1198486504 X:137092762-137092784 TGATTTGGTTAGAGTGGCCAGGG - Intergenic
1198622087 X:138524145-138524167 AGTATAAATTAGAGTGGTGATGG + Intergenic
1199665968 X:150096706-150096728 GGAATAAATTAGATTGTTCAGGG + Intergenic