ID: 1044323683

View in Genome Browser
Species Human (GRCh38)
Location 8:90835409-90835431
Sequence CCTCATAGACAGATAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044323683_1044323692 21 Left 1044323683 8:90835409-90835431 CCCTCCACTATCTGTCTATGAGG 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1044323692 8:90835453-90835475 TCATTGGACCACAATTTCATTGG No data
1044323683_1044323690 5 Left 1044323683 8:90835409-90835431 CCCTCCACTATCTGTCTATGAGG 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1044323690 8:90835437-90835459 GGGTGGTCATTTCCTTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044323683 Original CRISPR CCTCATAGACAGATAGTGGA GGG (reversed) Intronic
900039903 1:451271-451293 CATAATGGTCAGATAGTGGAGGG + Exonic
900061335 1:686247-686269 CATAATGGTCAGATAGTGGAGGG + Exonic
902819321 1:18933957-18933979 CCACAGAGACAGAAAGTAGAAGG - Intronic
907116034 1:51969342-51969364 CCTCATAGACAGAGAAAGGAGGG - Intronic
907731267 1:57068203-57068225 CCTCATATTCAGATACTGTAAGG + Intronic
907986914 1:59541254-59541276 CCCCATAGAAAGATGATGGAAGG + Intronic
909300218 1:74003313-74003335 CCTAAGAGACAGAGAGTGTAAGG - Intergenic
912375230 1:109204364-109204386 TGTCATAGAGTGATAGTGGAAGG - Intronic
912573210 1:110639955-110639977 CTTCATCAACAGATAATGGAAGG + Intergenic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
914195164 1:145444447-145444469 CATCTTTGACAGATAATGGAAGG + Intergenic
914476435 1:148027023-148027045 CATCTTTGACAGATAATGGAAGG + Intergenic
916186472 1:162138512-162138534 CATCCTGGATAGATAGTGGAGGG + Intronic
918073017 1:181147677-181147699 CCTCATAGTCAGAAAGTTCATGG + Intergenic
920745781 1:208626899-208626921 CATCATAGACAGATACAGGAGGG - Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922551035 1:226494740-226494762 CCTCATACACAGACAGAGGGAGG + Intergenic
924317878 1:242817306-242817328 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1063519228 10:6725890-6725912 ATTCATAGACAGAAAGTAGAAGG - Intergenic
1065827021 10:29582017-29582039 ATTCAGAGACAGATAGTAGAAGG + Intronic
1067824209 10:49558098-49558120 CACCATAGACATTTAGTGGACGG + Intergenic
1070276304 10:75010720-75010742 CCCCACAGACCGATGGTGGAGGG - Intronic
1070409034 10:76122367-76122389 CCTCACAGACAGGCAGGGGAAGG - Intronic
1075270628 10:121046646-121046668 CTTCATAGCCAGAAAGTGGCAGG - Intergenic
1075806466 10:125192666-125192688 TCTCAGAGACAGACAGTTGAAGG - Intergenic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1077388811 11:2289737-2289759 CCATAGAGACAGAAAGTGGATGG + Intergenic
1078745932 11:14114235-14114257 ACTCATAGACATAGAGTTGAAGG - Intronic
1080712866 11:34767607-34767629 ACAAATAGACAGAAAGTGGAAGG - Intergenic
1081347737 11:42010979-42011001 AGTCATAGACAGCTAATGGATGG - Intergenic
1081504431 11:43700518-43700540 ACTCATGGACAGACAGTAGAAGG - Intronic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1085972500 11:81610429-81610451 CCTTATAGACACATAGCCGATGG - Intergenic
1088456340 11:110036570-110036592 CCACAGAGACAGAGACTGGATGG - Intergenic
1091271851 11:134319825-134319847 CCTTGTAGACACATAGTTGAAGG - Intergenic
1092069107 12:5618264-5618286 GCCCATAGACAGAGAGTGGGAGG + Intronic
1098887292 12:75973389-75973411 CCTCATAGATAAACATTGGAGGG + Intergenic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1106689074 13:32094543-32094565 ACTCATAGACACAGAGTAGAAGG - Intronic
1106903868 13:34384412-34384434 GCTCATAGACAAAGAGTTGAAGG - Intergenic
1111319649 13:86610180-86610202 CTTTATAGACAGATAGATGATGG - Intergenic
1111992690 13:95132870-95132892 ACTCAGAGACAGAAAGTAGAAGG + Intronic
1112523035 13:100115231-100115253 ACTCATAGAGAGAGAGTAGAAGG + Intronic
1116497881 14:45584766-45584788 ACGCATAGACTGATAGTGAAGGG - Intergenic
1117385954 14:55212936-55212958 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1118005473 14:61561379-61561401 CCTCTGAGACAGACAGTGGTGGG - Intronic
1120061515 14:79988891-79988913 CCACATAAATAGAGAGTGGAGGG + Intergenic
1123141589 14:106084740-106084762 CCTCATAGAAAGAGTTTGGAGGG - Intergenic
1123200063 14:106654386-106654408 CCTCATAGAAAGAGTTTGGAAGG - Intergenic
1131247420 15:90807364-90807386 CCTCAGAGACAAATAGTGCCTGG + Intronic
1131337896 15:91567523-91567545 CCTCATAGCCAGAAAGCAGAAGG - Intergenic
1132306891 15:100821778-100821800 CTTCATAGACAGAAAGTAGTTGG + Intergenic
1132442004 15:101876348-101876370 CATAATGGTCAGATAGTGGAGGG - Intergenic
1133714526 16:8434195-8434217 AATCATAGACATAGAGTGGAGGG + Intergenic
1134218383 16:12334125-12334147 CCTCAAAGACCTAAAGTGGATGG - Intronic
1137410967 16:48227828-48227850 CATCATGGACTGACAGTGGAGGG + Exonic
1139073781 16:63418032-63418054 CCTGAGAGACAGATAGTGAGAGG - Intergenic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1143505704 17:7363819-7363841 CCCAAGAGACAGAGAGTGGAAGG - Intergenic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1144333997 17:14252930-14252952 TCTCCTAGGCAGATAGGGGAGGG + Intergenic
1145262670 17:21364174-21364196 CCGCATGGTGAGATAGTGGATGG + Intergenic
1146587595 17:34095810-34095832 GTTCATAGACAGAAAGTGAAGGG + Intronic
1146593840 17:34152848-34152870 CCTCATTGACCTAGAGTGGAAGG - Intronic
1149223609 17:54442934-54442956 CCTCATAGCCAGATAGGTCAGGG + Intergenic
1149359608 17:55880380-55880402 ACTCATAGACAAAGAGTAGAAGG + Intergenic
1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG + Intergenic
1157531216 18:48422532-48422554 ACTCATAGACAGAAAGTCGCAGG + Intergenic
1159884433 18:73890881-73890903 CCTCATAGAGAGAAAGGGCAGGG + Intergenic
1160278488 18:77462917-77462939 TCTTCTAGACAGATAGAGGAGGG + Intergenic
1160642929 19:156810-156832 CATAATGGTCAGATAGTGGAGGG + Intergenic
1162813506 19:13179253-13179275 CCACAGAGACAGAAAGTAGATGG - Intergenic
925193285 2:1902707-1902729 CCTCTGAGACAGACAGTGCAGGG - Intronic
926926674 2:17994807-17994829 TCTCCTAGACAGATAGGGGAGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
936648847 2:114403308-114403330 CCTCATGGACAGATACTGATTGG + Intergenic
937525591 2:122765071-122765093 CAGCACAGACAGACAGTGGAAGG - Intergenic
941348571 2:164402481-164402503 ACTCATGGACAGAGAGTAGAAGG + Intergenic
942163263 2:173214973-173214995 CCTGAGAGACAGATTGAGGAAGG + Intronic
942543341 2:177037374-177037396 AGTCATAGAAAGATCGTGGAAGG - Intergenic
947738344 2:232471512-232471534 ACTCATAGACTGAAAGTGAAAGG - Intergenic
1169858574 20:10129118-10129140 CTACATAGACAGGTTGTGGAGGG + Intergenic
1172186668 20:33035232-33035254 CCTGATTGACTGATAGTGGCTGG + Intronic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1174831398 20:53815831-53815853 CCTCATAGAATGAGATTGGAAGG + Intergenic
1180299266 22:11023789-11023811 CTAGATAGGCAGATAGTGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
953168544 3:40486871-40486893 TCCCACAGACTGATAGTGGAGGG + Exonic
953481028 3:43252356-43252378 CCCCTTTGACAGATTGTGGAAGG + Intergenic
960157353 3:114309352-114309374 CCTCTGAGAGAGATGGTGGAAGG - Exonic
960340401 3:116468067-116468089 CTCCAGTGACAGATAGTGGAAGG + Intronic
962392364 3:134983810-134983832 CCTCATAGACAGGTGGTTGATGG + Intronic
964961328 3:162431199-162431221 CCTCATAGAATGACATTGGAAGG - Intergenic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
967432907 3:189408227-189408249 GCTCATATACTGCTAGTGGAAGG + Intergenic
971685505 4:29760959-29760981 CCTCAGAGAAAGAAAGGGGAAGG - Intergenic
973667172 4:53173445-53173467 ACACATAGACTGATAGTGAAGGG - Intronic
974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG + Intergenic
975557533 4:75679395-75679417 CCTCACAAACAGATAATGGCTGG - Intronic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
992186920 5:74252845-74252867 CCTCATAGGGTGATTGTGGAAGG + Intergenic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
994796340 5:104305517-104305539 CAACATAGACAGAGAATGGAAGG - Intergenic
995353218 5:111206373-111206395 CATCATAGACAGATATTGTTAGG + Intergenic
995886195 5:116896788-116896810 CCTCATACATTGCTAGTGGAAGG - Intergenic
1000294739 5:159903333-159903355 TCACATGGACAGAGAGTGGAAGG - Intergenic
1001240486 5:170065898-170065920 ACTCATAGACTGAAAGTGAAGGG + Intronic
1002733944 5:181367672-181367694 CATAATGGTCAGATAGTGGAGGG - Exonic
1002750599 6:106450-106472 CATAATGGTCAGATAGTGGAGGG + Intergenic
1004499847 6:16199644-16199666 CCTCTTAGAAAGTTAGTGGCAGG - Intergenic
1007142062 6:39585999-39586021 CCTCATACACAGATTTTGGAAGG - Intronic
1007150005 6:39680547-39680569 TCTCACAGATAGATAGTAGAGGG + Intronic
1008251358 6:49243943-49243965 CCTCTTAGTCAGAGAATGGAGGG + Intergenic
1010319501 6:74489464-74489486 CCTCATAGGACAATAGTGGAGGG - Intergenic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1012816932 6:104035204-104035226 ACTCATAGAAACATAGTAGAAGG + Intergenic
1014080510 6:117281375-117281397 ACTCATTGACTGACAGTGGAAGG - Intergenic
1014919908 6:127201929-127201951 CATCATAGCCAGATAGTTGACGG - Intergenic
1015361568 6:132345518-132345540 TATTATAGACAGATAATGGATGG - Intronic
1017901971 6:158726209-158726231 CCTCTTTGACAGATGGTGTAGGG - Intronic
1018636716 6:165867298-165867320 ACACATAGACTGAAAGTGGAGGG + Intronic
1019135948 6:169907815-169907837 CCTCCTTGACTGAGAGTGGAGGG + Intergenic
1019238191 6:170639990-170640012 CATAATGGTCAGATAGTGGAGGG - Intergenic
1020458770 7:8404493-8404515 ATTCATAGACAGAAAGTAGAAGG + Intergenic
1021953768 7:25802968-25802990 CCTCCTAAAAAGATATTGGAAGG + Intergenic
1023037562 7:36146941-36146963 CCTTATAGCCAGAGAGTGGCTGG - Intergenic
1024622126 7:51169660-51169682 ACTCATTGACAGAGAGTAGAAGG + Intronic
1024629397 7:51235008-51235030 CCCCAGAGACAGGTTGTGGAGGG - Intronic
1027969758 7:85063893-85063915 CTGCATAGATAGATAGGGGAGGG - Intronic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028484127 7:91339818-91339840 CTTCAAAGACAGCTAATGGATGG - Intergenic
1029578232 7:101418379-101418401 CCTAAGAGACAGAAAGTAGATGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030114376 7:106051911-106051933 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1035509576 8:166617-166639 CATAATGGTCAGATAGTGGAGGG + Exonic
1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG + Intergenic
1038039870 8:23715447-23715469 CCACATATACAGCCAGTGGAGGG - Intergenic
1040535572 8:48306493-48306515 CCTCCAAGACAAAGAGTGGACGG + Intergenic
1043916309 8:85926575-85926597 CCTCACAGACACATACTGAAGGG + Intergenic
1043984667 8:86679927-86679949 CCTCGTAGATGGATAGTAGATGG - Intronic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045249976 8:100475023-100475045 CCTCACTGACAGAGATTGGAGGG + Intergenic
1046726386 8:117679007-117679029 CCCCATAGAAAGTAAGTGGAGGG - Intergenic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1050601674 9:7259090-7259112 CCACATAGATAGAAAGTGGTAGG - Intergenic
1050833461 9:10044904-10044926 ACTCATAAACTGATAGTGAAAGG - Intronic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1054796745 9:69309247-69309269 CCACATAGGCAGCTAGTGGCAGG + Intergenic
1059243481 9:112828945-112828967 CCACAGAGACAGACAGTAGATGG - Intronic
1060749106 9:126157204-126157226 CCACAGAGACAGAAAGTGGGAGG - Intergenic
1062758397 9:138320282-138320304 CATAATGGTCAGATAGTGGAGGG - Intergenic
1185659161 X:1713147-1713169 ACTCAAAGACAGACAGAGGAGGG + Intergenic
1186261488 X:7784732-7784754 CCATAGAGACAGAAAGTGGATGG + Intergenic
1190328434 X:49220974-49220996 ACACATAGACAGGTAGTGGTGGG + Intronic
1191640425 X:63425591-63425613 CCTCTTAATCAGATAGTGAAAGG + Intergenic
1192846528 X:74911530-74911552 CCACATATACACATACTGGAAGG + Intronic
1194449130 X:94020983-94021005 CCTCATATATACATGGTGGATGG - Intergenic
1194951001 X:100125790-100125812 CTTCATAGGCAGATACTGAAAGG + Intergenic
1197022039 X:121702977-121702999 ACACATAGACAGAAAGTGAAGGG - Intergenic
1200179535 X:154141798-154141820 CCATAGAGACAGACAGTGGAAGG - Intergenic
1201221355 Y:11773817-11773839 TCTCCTAGGCAGATAGGGGAGGG - Intergenic
1201502151 Y:14656698-14656720 CTTAATACACAAATAGTGGATGG - Intronic