ID: 1044325404

View in Genome Browser
Species Human (GRCh38)
Location 8:90852586-90852608
Sequence CTTTACAGGCAGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 321}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044325404_1044325417 21 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325417 8:90852630-90852652 GAGGAGAAGCGGTGGGATGTTGG No data
1044325404_1044325419 26 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325419 8:90852635-90852657 GAAGCGGTGGGATGTTGGGCTGG No data
1044325404_1044325416 14 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325416 8:90852623-90852645 CAGCAGAGAGGAGAAGCGGTGGG No data
1044325404_1044325418 22 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325418 8:90852631-90852653 AGGAGAAGCGGTGGGATGTTGGG No data
1044325404_1044325411 2 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325411 8:90852611-90852633 CCCAGACTCAGCCAGCAGAGAGG No data
1044325404_1044325413 10 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325413 8:90852619-90852641 CAGCCAGCAGAGAGGAGAAGCGG No data
1044325404_1044325415 13 Left 1044325404 8:90852586-90852608 CCCTCCATCCTCTGCCTGTAAAG 0: 1
1: 0
2: 4
3: 58
4: 321
Right 1044325415 8:90852622-90852644 CCAGCAGAGAGGAGAAGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044325404 Original CRISPR CTTTACAGGCAGAGGATGGA GGG (reversed) Intronic
900705381 1:4077104-4077126 TTTTATAGGCAGAGCATGGATGG - Intergenic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
901941006 1:12661646-12661668 CTGTCCAGGCAGAGGAGGCAAGG + Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903491336 1:23731005-23731027 ATTTATAGGCAGAGGTTGGTGGG - Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
907101310 1:51839267-51839289 CTTGACAGGCTGAAGATGGGAGG - Intronic
907431456 1:54414482-54414504 CATTACAGCCAGAGGAAGGAAGG - Intergenic
908229235 1:62087362-62087384 CTTTGTAGGCATAGGATGGGGGG + Intronic
908676834 1:66614376-66614398 ATTTATAGCCAAAGGATGGATGG + Intronic
909818457 1:80027553-80027575 TTTTAAAGGCACAGGATGGGGGG - Intergenic
910166974 1:84338134-84338156 GGTAACAGGCAGAGGTTGGAGGG - Intronic
910478542 1:87634253-87634275 GTTTATAGGCACAGGATGGAGGG + Intergenic
911429988 1:97773536-97773558 TTTTATAGGCACAGGATGGGGGG - Intronic
915216284 1:154342818-154342840 CTTGTCAGCCAGAGGATTGAAGG - Exonic
916900330 1:169215292-169215314 CTTTATAGGCACAGGATGGGGGG + Intronic
917254911 1:173103865-173103887 TTTTATAGGCACAGGATGGGGGG + Intergenic
918245043 1:182651786-182651808 GGCTACAGGCAGAGGTTGGAGGG + Intronic
918368722 1:183837315-183837337 CTTTACAGACAGAGATTGGTTGG + Intronic
918376207 1:183911720-183911742 CTTCACAGGCAAAGAAGGGATGG - Intronic
918910528 1:190562816-190562838 CTTTACAGGCACAAGATGGGGGG - Intergenic
919479121 1:198064647-198064669 CTTTCCAGCCAAAGGCTGGAGGG - Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920513231 1:206565954-206565976 CATGACAGGCAGGGGAAGGAAGG + Intronic
920911148 1:210218103-210218125 CTTTTCTGTCAGAGGGTGGAAGG + Intergenic
922623504 1:227011892-227011914 CATTAGAGGCAGAGGGTGAATGG + Intronic
924383658 1:243484141-243484163 TTTAACAGACAGAGGATGGCAGG - Intronic
924806441 1:247365431-247365453 GGTAACAGGCAGAGGTTGGAGGG + Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1064485382 10:15783150-15783172 CTTTAGAGACAGGGGATGGGAGG + Intronic
1064700103 10:18009600-18009622 CTTTGCAGGCAGGGGATTGGGGG + Intronic
1064795860 10:19010254-19010276 TTTTATAGGCACAGGATGGGGGG + Intergenic
1066754814 10:38700571-38700593 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1068015947 10:51516362-51516384 CTTTATAGGCACAGGATGGGAGG + Intronic
1069078190 10:64060555-64060577 CTTTGCAGGCAGAGAATGAGTGG - Intergenic
1070530169 10:77330093-77330115 TTTCTCAGGCAGAGGATAGAAGG - Intronic
1070659412 10:78293878-78293900 CTTTAATGGCAAAGGAGGGATGG + Intergenic
1071152622 10:82652600-82652622 TTTTATAGGCAGAGGATGTCAGG + Intronic
1071893837 10:90042208-90042230 TTTTACAGGCACAGGATTGGGGG + Intergenic
1072208666 10:93226376-93226398 CTTTATAGGCACAGGATGGTGGG + Intergenic
1072460390 10:95612959-95612981 CTTTCCAGTCAAAGGATGGAAGG + Intronic
1073146478 10:101284989-101285011 CTTTGCAGGAAGAGGAAGGGAGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076143216 10:128096174-128096196 CTTGAGAGGCTGAGGAGGGAGGG - Intergenic
1077799601 11:5524865-5524887 GGGTACAGGCAGAGGTTGGAGGG - Intronic
1078090361 11:8261240-8261262 CTGGACAGGCTGGGGATGGAGGG + Intronic
1078497010 11:11827619-11827641 CTTGAGAGGCTGAGGTTGGAGGG - Intergenic
1078624416 11:12940867-12940889 CTTTAGAGATGGAGGATGGAAGG + Intronic
1080565820 11:33508458-33508480 CTTTACAGGCAAAAGAGGAAAGG + Intergenic
1080604433 11:33853066-33853088 CTATATAGGCACAGGATGGCGGG + Intergenic
1081542986 11:44049511-44049533 CTCTCCAGCCAGAGGGTGGAGGG + Intronic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084478070 11:69400173-69400195 CTCTACAGGCCCTGGATGGATGG + Intergenic
1085949552 11:81313204-81313226 GTTCACAGACAGAGGATGGTTGG + Intergenic
1086287440 11:85265721-85265743 CTTTATAGGCACAGGATGGTGGG - Intronic
1087575609 11:99985462-99985484 CTTTATAGGCACAGGATGATGGG + Intronic
1087677048 11:101175460-101175482 TTTTACAGGCACAGGATGGGGGG - Intergenic
1088537048 11:110872678-110872700 CTTAACTGTCAGAGGATGCAGGG - Intergenic
1088760056 11:112920941-112920963 ATATACAGGCAGCGGAAGGAGGG + Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089573098 11:119422953-119422975 CTTTCCAGGCAGGGGCGGGAGGG - Intronic
1089696812 11:120220995-120221017 CTTGACAGTTAAAGGATGGAGGG - Intronic
1089713936 11:120337368-120337390 GTTGACAGGCAGAGGAAAGAGGG + Intronic
1090248711 11:125236345-125236367 CTTTCCTGGAACAGGATGGAGGG - Intronic
1091311505 11:134578201-134578223 CTTGGCAGGCAGGGGATGGGGGG + Intergenic
1092241688 12:6839761-6839783 CTTTAAATGAAGAGGATGGTGGG + Exonic
1093755832 12:22850896-22850918 CTTTATAGGCACAGGATAGTGGG + Intergenic
1097746630 12:63310633-63310655 CTTTATAGGCACAGAATGGGGGG + Intergenic
1098488403 12:71047648-71047670 CTTTATAGGCACAGGAGGGAGGG + Exonic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1101216714 12:102593102-102593124 TTTTATAGGCACAGGATGGGGGG + Intergenic
1102603239 12:114049270-114049292 CTTTATATGCAGAGCAAGGAAGG - Intergenic
1102899682 12:116626589-116626611 ACTTACAGAAAGAGGATGGAGGG + Intergenic
1106804045 13:33287805-33287827 TTTTACTGGAAGAGAATGGAAGG + Intronic
1106870203 13:34011309-34011331 CTTTATGGGCACAGGATGGGGGG - Intergenic
1108248574 13:48542261-48542283 TTTTATAGGCACAGGATGGGGGG - Intergenic
1108981893 13:56524405-56524427 GGTAACAGGCAGAGGTTGGAAGG - Intergenic
1109313983 13:60727963-60727985 CTTTGTAGGCACAGGATGGAGGG + Intergenic
1110300137 13:73916596-73916618 TTTTACAGGCAGAGAATAGGAGG - Intronic
1111601723 13:90482618-90482640 GATAACAGGCAGAGGTTGGAGGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113633490 13:111904240-111904262 CTTTAGAGGGAGGGCATGGAGGG + Intergenic
1115012979 14:28572873-28572895 TTTTATAGGCACAGGATGGCAGG + Intergenic
1115245196 14:31287439-31287461 ATTTATAGGCACAGGATGGGGGG + Intergenic
1115982324 14:39067286-39067308 CTTTCCATGCAGAGGATACATGG - Exonic
1116350341 14:43854129-43854151 CTTCACTGGCTGAGGATGCAAGG + Intergenic
1116712296 14:48383645-48383667 CCTTATAGGCACAGGATGGGGGG + Intergenic
1117434517 14:55703343-55703365 AATCACAGGCTGAGGATGGAGGG + Intergenic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118667497 14:68086385-68086407 TTTTATAGGCACAGGATGGGGGG + Intronic
1119936570 14:78597609-78597631 CTTCACGGGCAGAGGATCTAAGG - Intronic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1122114259 14:99520053-99520075 CCTGACAGCCAGTGGATGGAGGG + Intronic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1124827088 15:33108103-33108125 CTTCCCTGGCACAGGATGGATGG + Intronic
1124930451 15:34114620-34114642 CTTTATAGGCACAGTATGGCGGG - Intergenic
1125159709 15:36628704-36628726 CTTTAAGGCCAGAGGGTGGATGG + Intronic
1125892345 15:43276050-43276072 GCCTGCAGGCAGAGGATGGAGGG - Intergenic
1125931854 15:43605775-43605797 CTTCACAAGCAGAGGAAGGGTGG - Intronic
1125944953 15:43705253-43705275 CTTCACAAGCAGAGGAAGGGTGG - Intergenic
1128308479 15:66615546-66615568 ATGGACAGGCAGATGATGGAAGG + Intronic
1129142912 15:73617919-73617941 CTTTACAGCTGGAGGATGAAAGG - Intronic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1133663203 16:7939100-7939122 CTTCAGTAGCAGAGGATGGAAGG + Intergenic
1133779241 16:8924456-8924478 CTCTACAGGCAGTGCCTGGAAGG + Intronic
1134690953 16:16190847-16190869 CTGAGCAGGCAGAGGATGGGGGG + Intronic
1135008734 16:18853900-18853922 CTTTAAAAGCAAATGATGGAGGG + Intronic
1135832291 16:25786238-25786260 CTTTATAGGCAGTGAATGGTTGG + Intronic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1136727874 16:32376267-32376289 CTTTCCAGGCTGAGGTTGCATGG - Intergenic
1137885215 16:52095661-52095683 TTTGCCAGGCAGAGGAAGGAAGG + Intergenic
1138588522 16:57986550-57986572 TTTTCCAGGCAGAGGAGGAAGGG - Intronic
1138686399 16:58729828-58729850 CTTAAAAGACAGAGGCTGGAGGG - Intronic
1138910820 16:61396728-61396750 CTTTCCAGGCATAGGATAGATGG + Intergenic
1142301781 16:89262872-89262894 CTTTATAGACACAGGATGGCGGG + Intergenic
1142318816 16:89367577-89367599 CTTGTCAGGCTGAGGAGGGACGG - Intronic
1142422373 16:89979786-89979808 CATTACAGGAAGAGGCTGGTAGG + Intergenic
1202998561 16_KI270728v1_random:141487-141509 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1203130158 16_KI270728v1_random:1677891-1677913 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1143858421 17:9869947-9869969 CTTTAAAGGCTGACAATGGAGGG + Intronic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1144300825 17:13921990-13922012 TTTTATAGGCACAGGATGCAGGG - Intergenic
1144467713 17:15509544-15509566 GTTAATAGGCAGAGGAAGGATGG - Intronic
1145797773 17:27665915-27665937 TTTTACAGGCAGAGCATCCAGGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147139782 17:38454399-38454421 GTTTCCAGGCAGTGGAAGGATGG + Intronic
1148477711 17:47940292-47940314 CTTTCCAGGCTGTGGATGCAAGG - Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1149018402 17:51934994-51935016 CTTTACATGCAGAGCAAGGATGG + Intronic
1149057104 17:52379638-52379660 CTTTATAGGCACAGGATGGGAGG - Intergenic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1152074539 17:78150747-78150769 CATTAGATGTAGAGGATGGAGGG + Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1155787157 18:29915213-29915235 TTTTTCAGGCAAAGGATGGAGGG - Intergenic
1155799947 18:30089295-30089317 CTTTATAGGCACAGGATGGAGGG - Intergenic
1156540650 18:37906447-37906469 TCTTACTGGCAGAGAATGGAAGG - Intergenic
1156651698 18:39233690-39233712 CTTTATAGGCACAGTATGGGGGG + Intergenic
1156676426 18:39531913-39531935 GTTTCCATGCAGAGAATGGACGG + Intergenic
1156789147 18:40950827-40950849 GGTTACAGGTGGAGGATGGATGG - Intergenic
1158239602 18:55361684-55361706 CATTACAGGCAGATGTGGGAGGG + Intronic
1161721675 19:5906071-5906093 CTTGAGAGGCTGAGGAGGGAGGG - Intronic
1163833297 19:19558199-19558221 CGCTACAGGCAGAGGAGGGCGGG + Intergenic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165070527 19:33252769-33252791 CTTTACTGGCAGAAGAAGGTTGG + Intergenic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1167645501 19:50703179-50703201 CTGAACAGGAAGAGGATGGGGGG - Intronic
925807750 2:7668095-7668117 TTTTACAGGCAGAGCAGAGATGG + Intergenic
926562741 2:14435308-14435330 CTTTATAGGCACAGGATGGGGGG + Intergenic
929215562 2:39408186-39408208 CTTTACAGACAAAGCATGGAAGG - Intronic
929906956 2:46054797-46054819 TTTTATAGGCACAGGATGGGGGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932360746 2:71103719-71103741 CTTTATAGGCACAGGAAGGGGGG - Intergenic
932837399 2:75050397-75050419 CCTTACAGGCTGAGGACTGATGG + Intronic
933298257 2:80514785-80514807 CTTTATAGGCACAGGATGGGGGG + Intronic
933331081 2:80893901-80893923 CTTTGCAAACAGAGAATGGAGGG + Intergenic
934318101 2:91944806-91944828 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
935082601 2:99813168-99813190 GGTTGCAGGCAGAGGTTGGAGGG + Intronic
936858379 2:116987228-116987250 CTTTATAGGCACAGGATGGGGGG - Intergenic
937478049 2:122232477-122232499 CTTCCAAGGCACAGGATGGAGGG - Intergenic
937743744 2:125386688-125386710 TTTTATAGGCACAGGATGGGGGG + Intergenic
937770953 2:125720725-125720747 CTTTATAGGCACAGGATGGTGGG - Intergenic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938150732 2:128880172-128880194 TTTTATAGGCACAGGATGGGGGG + Intergenic
939225617 2:139360313-139360335 CTTTACATGCTAAGGAGGGAGGG - Intergenic
941595987 2:167477840-167477862 CTTTACAGGAAAAGCATGGGTGG - Intergenic
942160531 2:173181272-173181294 CTTGTGAGGCAGAGGATGGCAGG + Intronic
942846257 2:180429341-180429363 GGTAACAGGCAGAGGTTGGAAGG - Intergenic
943532686 2:189104263-189104285 TTTTACAGGTAGAGGAAGAAAGG - Exonic
943563913 2:189495419-189495441 AGTAACAGGCAGAGGTTGGAAGG + Intergenic
943969558 2:194386138-194386160 CTTTATAGGCACAGGATGTAGGG - Intergenic
944471327 2:200056075-200056097 GTTGACAGGCAGAGGATGTGGGG - Intergenic
945282678 2:208050750-208050772 CTTTCCAGGCAGGGCATGGTTGG - Intergenic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
946471382 2:219964241-219964263 TTTTATGGGCATAGGATGGAGGG - Intergenic
946729318 2:222692983-222693005 CTTAAGAGGCAGAGGATGCTGGG - Intronic
947227321 2:227852934-227852956 CTTTACAGGCACAGGATCGGGGG + Intergenic
947643574 2:231721626-231721648 CTTTCCAAGCAGAGGAAAGACGG + Intergenic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
947888417 2:233594666-233594688 GATAACAGGCAGAGGTTGGAAGG + Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948159750 2:235814090-235814112 TTTTATAGGCACAGGATGGGGGG + Intronic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948922557 2:241072572-241072594 CTCCTCAGGCAGAGGAGGGAGGG + Intronic
1169834033 20:9857874-9857896 CTATACAGGCACAGGCTAGAAGG - Intergenic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1172949405 20:38713089-38713111 CTTTAGAGGCAGTCGATGGAAGG + Intergenic
1174086772 20:48014415-48014437 CTCTCCAGGCAAAGGTTGGAGGG + Intergenic
1174284707 20:49464528-49464550 CTTTTCAGGCAGGGAGTGGAGGG - Intronic
1174384217 20:50177153-50177175 CTTGGGAGGCAGAGGAGGGAAGG + Intergenic
1175906572 20:62382809-62382831 CTGTACAGACAGCGGGTGGAGGG + Intergenic
1177229584 21:18302328-18302350 TTTTACAGGCAGAGGCTTGGTGG + Intronic
1177491408 21:21830740-21830762 TTTTACAGGCACAGGATGGGAGG - Intergenic
1177495573 21:21886017-21886039 CTTTACAGTAAGAGGTGGGAAGG + Intergenic
1177564165 21:22796517-22796539 TTTTATAGGCACAGGATGCAGGG + Intergenic
1177761726 21:25409174-25409196 TTTTACAGGCAGGGGATGAAGGG + Intergenic
1177801556 21:25833554-25833576 CTTTATAGGCACAGGATGGGGGG - Intergenic
1177962112 21:27680108-27680130 CTTTATAGGCACAGGATGTGGGG + Intergenic
1180092394 21:45539797-45539819 CTTAAGAGGCAGAGGCTGGTGGG + Intronic
1180306273 22:11128490-11128512 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1180544792 22:16490673-16490695 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1181528235 22:23502127-23502149 ATAGACAGGCAGATGATGGATGG - Intergenic
1182006596 22:26965343-26965365 TTTTACAGGCCAAGGATGGCAGG + Intergenic
1184249839 22:43253771-43253793 CTTCCCAGGAAGAGGATGGGTGG - Intronic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
949956684 3:9274922-9274944 TTTTATGGGCACAGGATGGAGGG + Intronic
950254512 3:11493355-11493377 CTTTATAGACACAGGATGGGGGG + Intronic
950398798 3:12754350-12754372 CTGTACAGAAAGAGGATGGTTGG + Intronic
950501248 3:13365328-13365350 TTTTACAGGCAGGGAATGTAAGG + Intronic
951579474 3:24146768-24146790 ATTTACAGGAATAGGATGGATGG + Exonic
951663095 3:25092508-25092530 CTTTACAGGCACACCATGAAAGG - Intergenic
952292881 3:32035484-32035506 CTTGGGAGGCAGAGGATGCAGGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954577333 3:51683890-51683912 CTTTACAGGCAGAGAAATTATGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
956490571 3:69767299-69767321 CTTTAAAGACAAAAGATGGAGGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957758362 3:84522555-84522577 TTTTATAGGCACAGGATGGGGGG - Intergenic
958549961 3:95599635-95599657 TTTTACACGGAGAGGGTGGAGGG - Intergenic
959452455 3:106520409-106520431 CTTTAAAGGCAGAGTAATGAAGG + Intergenic
959685156 3:109137316-109137338 CTTTAAAGGCAGATCAAGGAAGG + Intergenic
959926438 3:111926690-111926712 CTTCAGAGGCAGAGAATGGTTGG + Intronic
960621940 3:119645649-119645671 CTTCACAGGCATAGAATGGAGGG + Intronic
961101958 3:124207259-124207281 CTTTCCTGGCAGGGGAAGGAGGG - Intronic
962095156 3:132285435-132285457 TTTTATAGGCACAGGATGGGGGG + Intergenic
962484503 3:135829365-135829387 CTCTACAGTGAGTGGATGGAAGG - Intergenic
962873865 3:139520566-139520588 CTCTACAGGCCTGGGATGGAAGG - Intronic
963118294 3:141752827-141752849 CTTTATAGGAAGAGGATGAGAGG + Intergenic
963378853 3:144503993-144504015 GTTTATAGACACAGGATGGATGG + Intergenic
963534830 3:146514420-146514442 CTTTATAGGCACAGGATTGCAGG - Intergenic
963925097 3:150943360-150943382 ATTTATAGGCAGAGGATAGGTGG - Intronic
964307567 3:155357285-155357307 ATTTACAGGCACAGGATGGAGGG + Intergenic
964334293 3:155638843-155638865 CTTTACAGGCAAATGATTAAAGG + Intronic
966944833 3:184770462-184770484 GTCTACTGGCAGTGGATGGAAGG + Intergenic
967422565 3:189290274-189290296 ATTAACTGGCAGAGGAAGGATGG - Intronic
968330501 3:197865108-197865130 CTGTAGAGGCTGAGGAGGGAGGG - Intronic
970583671 4:17495239-17495261 CTTTACAGGCAGCAGAGTGATGG - Intronic
970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG + Intergenic
972357415 4:38293354-38293376 ATTTCCAGGCAGAGTATTGAAGG + Intergenic
975226466 4:71877923-71877945 ATTTACAGGCAAGGGATGGGGGG + Intergenic
977397315 4:96486770-96486792 CTGTTCAGGGAGGGGATGGAAGG + Intergenic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
978086384 4:104660694-104660716 GTTTACAGACAGAGAAAGGAAGG + Intergenic
978327367 4:107574868-107574890 TTTTATAGGCACAGGATGGAGGG - Intergenic
978491212 4:109314083-109314105 ATTTAAATGCAGAGGAGGGAAGG - Intergenic
979188094 4:117824128-117824150 CTTTATAGGCACAGGATGTTGGG - Intergenic
981652004 4:147070666-147070688 TTATACAAACAGAGGATGGATGG + Intergenic
981652051 4:147071415-147071437 CTCTGCAGTCAGAGGATGCACGG + Intergenic
982606545 4:157523490-157523512 CTTTATAGGCACAGGATGGGGGG + Intergenic
983172561 4:164552297-164552319 CTTTATAGGCACAGGATGCGGGG + Intergenic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
983803813 4:171968472-171968494 CCTTACAGGAAGAGGAAGAAAGG - Intronic
984359656 4:178711850-178711872 CTTTATAGGCATGGGATGGTGGG + Intergenic
985696412 5:1343301-1343323 CTCTTCAGGCAGAGGGTGCAGGG + Intronic
986083526 5:4418987-4419009 CTTGAGAGGCAGAGGTGGGAGGG + Intergenic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
990097154 5:52130973-52130995 CCGTACAGACAGAGCATGGAAGG + Intergenic
990792393 5:59496315-59496337 TTTTATAGGCACAGGATGGTAGG + Intronic
991217260 5:64170055-64170077 CTTGACAGGTAGAGGATGAAGGG - Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
992205902 5:74430074-74430096 CTTTATAGGCACAGGATAGGAGG - Intergenic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
992320056 5:75605060-75605082 CTTTACAGGCTGAGGTTAGAAGG - Intergenic
992619302 5:78576518-78576540 CTTTAAGGGCAGTGGAGGGAGGG + Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993979253 5:94524395-94524417 CTTGATAGGCAGTGGATGAAAGG + Intronic
994119983 5:96102442-96102464 CTTTATAGGCACAGGATGGGGGG + Intergenic
994559526 5:101349490-101349512 CTTTACAGGCAGCAGATGGGTGG - Intergenic
994986574 5:106941121-106941143 CTTTCCAGGCAAAGAATGGTAGG - Intergenic
996191627 5:120550385-120550407 TTTTACAGGCACAGGGTGTAGGG + Intronic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
996657812 5:125962519-125962541 CTTTACAGGCAGCAAATTGAAGG + Intergenic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999366354 5:151026269-151026291 ATTGCCAGGCAGAGCATGGAGGG - Intronic
999750650 5:154626064-154626086 CGTTACAGGCACAGGACTGATGG + Intergenic
1000516493 5:162241493-162241515 TTTTATAGGCATCGGATGGAGGG + Intergenic
1000736363 5:164906657-164906679 CTTTAGAGTCAGAGTATGAAAGG + Intergenic
1002276831 5:178109318-178109340 CTGTCCAGGCAGATGTTGGAGGG + Intergenic
1003108198 6:3231350-3231372 CTTCCCAGGCGGAGGAGGGAAGG - Intronic
1003136279 6:3436983-3437005 ATTTACAGACTGAGGATGTATGG - Intronic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004396550 6:15250534-15250556 CTGTACAGGGACAGTATGGAAGG + Intronic
1004706992 6:18133926-18133948 CTACACAGGCAAAGGCTGGAGGG + Intronic
1005029255 6:21493818-21493840 TTTTACAGGCACAGGATAGGGGG - Intergenic
1005507131 6:26479241-26479263 TTGGACAGGCAGACGATGGAGGG - Intergenic
1007959697 6:45947478-45947500 GTTGCCAGGCAGTGGATGGAGGG - Intronic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009765855 6:68074583-68074605 CTTTATAGGCATAGGATGGGTGG + Intergenic
1010732327 6:79404409-79404431 ATTTATAGGCACAGGATGGGAGG - Intergenic
1011408761 6:87044020-87044042 CTTTATAGGCACAGGATAGGGGG - Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1014107377 6:117582513-117582535 CTTTACTGGCACAGGATGGGGGG - Intronic
1014247300 6:119082002-119082024 TTTTATAGGCACAGGATGGTGGG + Intronic
1016083017 6:139878548-139878570 CTTTATAGGCATAGGATGGAGGG + Intergenic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1017727746 6:157287432-157287454 TTTTACAGCCAGAGGCTGCAAGG - Intergenic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1019566607 7:1684040-1684062 CTTGAGAGGCTGAGGAGGGAGGG + Intergenic
1020379483 7:7527491-7527513 ATTTAAAGGGAGTGGATGGAAGG + Intronic
1020864026 7:13533596-13533618 CTTCAGAGGCTGAGGATGGGAGG - Intergenic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1022563018 7:31369475-31369497 CTTTACAGGCACAGGATGCCGGG + Intergenic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1024550956 7:50562080-50562102 GCTTAAAGTCAGAGGATGGATGG - Intronic
1025104784 7:56162086-56162108 TTTTATAGGCACAGGATGGGGGG - Intergenic
1027624650 7:80531298-80531320 GGTAACAGGCAGAGGTTGGAAGG + Intronic
1028415165 7:90572455-90572477 GTCTTCAGGCAGAGGAGGGAAGG - Intronic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1034243306 7:149625659-149625681 CTTAAGAGGCTGAGGATGGAGGG + Intergenic
1034540083 7:151752398-151752420 CTTAAGAGGCAGAGGGTGGGAGG + Intronic
1034931251 7:155165778-155165800 TTTTATAGGCACAGGATGGGGGG - Intergenic
1035334946 7:158121801-158121823 CTTGCCAGGCTGAGGAAGGAAGG - Intronic
1035812053 8:2500777-2500799 CTTTGTAGGCACAGGATGGAAGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037533404 8:19802103-19802125 CTTTATAGCCACAGGATGGGGGG - Intergenic
1037594539 8:20343882-20343904 CTTTATAGGCACAGGATGGTTGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1039129901 8:34251167-34251189 CTTTACAGTAAGAAGATGAAAGG + Intergenic
1039426840 8:37493249-37493271 CTATCCAGGCAGGGGACGGAGGG - Intergenic
1039436786 8:37564939-37564961 CTTTAGAGGAGGAAGATGGAAGG - Intergenic
1039728959 8:40253898-40253920 GTTGACAGGTAGAAGATGGAAGG + Intergenic
1041039448 8:53832103-53832125 CTTTACAGGCATAGTAGGGAAGG + Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043438993 8:80260382-80260404 CTTTACAGGCACAAGATGGGGGG + Intergenic
1043484612 8:80686976-80686998 ATTTATAACCAGAGGATGGATGG + Intronic
1044302115 8:90596740-90596762 CACTGCAGGCTGAGGATGGAAGG + Intergenic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044765763 8:95572392-95572414 TTTTATAGGCACAGGATGGGGGG - Intergenic
1045744997 8:105408016-105408038 CTTTACAGGCAGAAGTTATAGGG - Intronic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1047085915 8:121514986-121515008 GTTTACAGGAAAAGGAGGGAGGG - Intergenic
1048123545 8:131608000-131608022 TTTTACAGGCACAGGATGGGGGG + Intergenic
1048509321 8:135048287-135048309 TTGTGCAGGCAGAGCATGGAGGG - Intergenic
1048791954 8:138112459-138112481 TTTTCCAGATAGAGGATGGAGGG - Intergenic
1049274479 8:141712957-141712979 CTTTTCAGAGGGAGGATGGAAGG + Intergenic
1049710036 8:144059332-144059354 CTGTTCAGGCAGAGGAGGGGTGG - Intronic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1050175332 9:2864182-2864204 CTTGGAAGGCAGAGGATGGGAGG + Intergenic
1051795685 9:20866990-20867012 CTTTTCAGGCAGATGAAGAATGG - Exonic
1051887185 9:21905341-21905363 TTTTACAGGCACAGGATGGGGGG + Intronic
1052122164 9:24731055-24731077 CTTTTTAGGCACAGGATGGGGGG + Intergenic
1053809709 9:41839681-41839703 TTTTATAGGCACAGGATGGGAGG + Intergenic
1054360525 9:64110189-64110211 CTTTACAGGAAGAGCAAGAAAGG + Intergenic
1054620884 9:67347747-67347769 TTTTATAGGCACAGGATGGGAGG - Intergenic
1054912700 9:70468451-70468473 AATTTCAGGCAGAGGAAGGAGGG - Intergenic
1055708499 9:79033870-79033892 CTTTATAGGCAAAGGATGGGGGG + Intergenic
1055961635 9:81826100-81826122 CTTGAGAGGCACAGAATGGAAGG + Intergenic
1056262478 9:84862739-84862761 ATTAAAAGGCAGAGGAGGGAAGG + Intronic
1057724945 9:97561819-97561841 CATTACAGGCAGAGGAATGCAGG - Intronic
1057742968 9:97728300-97728322 CTGTAAATGCAAAGGATGGAGGG - Intergenic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1061182290 9:129031820-129031842 CTTTATAGGTACAGGATGGGAGG - Intergenic
1061880150 9:133564879-133564901 CTTGCGAGGCACAGGATGGAGGG - Intronic
1187485111 X:19695727-19695749 CTCTGCAGGTAGAGGAAGGATGG - Exonic
1188180572 X:27050498-27050520 CTTTATAGGTACAGGATGCAGGG - Intergenic
1188553233 X:31383648-31383670 TTTTACAGGCACAGGATGGAGGG - Intronic
1189161857 X:38817340-38817362 CTTAACAGGCTGAGGAGGGAAGG - Intergenic
1189392135 X:40585251-40585273 CTTTACATGGAGAGGATGAGAGG + Intronic
1191146001 X:57165926-57165948 TTTTATAGGCACAGGATGGGGGG - Intergenic
1191939537 X:66463239-66463261 TTTTATGGGCACAGGATGGAGGG - Intergenic
1192229446 X:69255064-69255086 GATTAAAGGCAGAGGATGGGTGG + Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1195756768 X:108206302-108206324 CTTTAGAGGCACAGATTGGATGG + Intronic
1196873169 X:120131702-120131724 CTTTATAGACACAGGATGGGAGG + Intergenic
1198789496 X:140328094-140328116 CTTGAGAGGCTGAGGAGGGAAGG + Intergenic
1199988366 X:152968894-152968916 CTCTACAGACAGAGCATGAAGGG + Intronic
1199993725 X:153005598-153005620 GGTAACAGGCAGAGGTTGGAAGG - Intergenic
1201185656 Y:11399888-11399910 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1201339863 Y:12922941-12922963 TTTTATAGGCACAGGATGGGGGG + Intergenic
1202019662 Y:20451451-20451473 TATTATAGGCACAGGATGGAGGG - Intergenic