ID: 1044327149

View in Genome Browser
Species Human (GRCh38)
Location 8:90871709-90871731
Sequence TCTGGTTCATGGGATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044327149_1044327154 4 Left 1044327149 8:90871709-90871731 CCTACAGCATCCCATGAACCAGA 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1044327154 8:90871736-90871758 TTTATTACTATCCTCATCTTGGG No data
1044327149_1044327153 3 Left 1044327149 8:90871709-90871731 CCTACAGCATCCCATGAACCAGA 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1044327153 8:90871735-90871757 TTTTATTACTATCCTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044327149 Original CRISPR TCTGGTTCATGGGATGCTGT AGG (reversed) Intronic
900334761 1:2156958-2156980 ACTGGTTCATGGGATTATGGAGG + Intronic
900352728 1:2243703-2243725 TCTGCTGCATGGGATGCTAGGGG + Intronic
900480998 1:2899287-2899309 TCCGCTGCAGGGGATGCTGTAGG - Intergenic
901987361 1:13086568-13086590 TCTGGTTCCTGGGGGACTGTTGG - Intergenic
901994451 1:13140199-13140221 TCTGGTTCCTGGGGGACTGTTGG + Intergenic
902235855 1:15056978-15057000 TCTGGTGCATTGGCTGCTGCTGG - Intronic
902332381 1:15736890-15736912 GCTGGGTCATGGGATGGTGGAGG - Intronic
902708079 1:18220297-18220319 TTGGTTTCATGGGAGGCTGTTGG + Intronic
904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG + Intergenic
906075573 1:43049536-43049558 TCTGGCTCACGGGAAGCTGTGGG + Intergenic
906194545 1:43921582-43921604 TCTGGGTGATGGGAGGTTGTTGG + Intronic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
906575684 1:46887119-46887141 TCTGCTTCTTGGGAGGCTGCAGG - Intergenic
906596292 1:47080777-47080799 TCTGCTTCTTGGGAGGCTGCAGG + Intronic
912162824 1:107007048-107007070 TCTGGGTCATGTGCTGCAGTGGG - Intergenic
912752584 1:112298051-112298073 TCTGGTTCAAGCCATGCTGATGG - Intergenic
919848884 1:201659104-201659126 TCTGGTTCAAGCTTTGCTGTGGG - Intronic
922181895 1:223242377-223242399 TCTGGTGTCTGGCATGCTGTGGG + Intronic
922355934 1:224775051-224775073 TCTTGCTCCTGGGATGCTGTGGG - Intergenic
922892227 1:229070932-229070954 TCTGGTTGATGGGAAGTAGTGGG + Intergenic
922903017 1:229152194-229152216 TCTGTGGCATGTGATGCTGTTGG + Intergenic
923570714 1:235111266-235111288 TCTGATTCATTGGGTTCTGTTGG - Exonic
923898398 1:238298737-238298759 TCTGTAGCATGTGATGCTGTTGG - Intergenic
924367712 1:243313552-243313574 TCTGGATCATGGAATGTTGCAGG + Intronic
924499825 1:244626792-244626814 TTTGGTTTAAGGGATGTTGTGGG + Intronic
1063007710 10:1989711-1989733 TCTTGTTCAAAGGATGCAGTAGG - Intergenic
1063473393 10:6307246-6307268 ACTGGCTCATGGGATTCTGGGGG - Intergenic
1063726336 10:8641611-8641633 TGTGGTTCAGGAGCTGCTGTTGG - Intergenic
1064027674 10:11861483-11861505 TGTGATTCAGGGGATGCTGTGGG + Intronic
1064532024 10:16320287-16320309 ACTGCTTCTTGGGATGCTCTAGG + Intergenic
1064681396 10:17814084-17814106 TCTGCTTTATGGGAAGCTATGGG - Intronic
1066374786 10:34848081-34848103 TCTGCAGCATGTGATGCTGTTGG + Intergenic
1066514032 10:36135498-36135520 TTTAGTTCATTGGATGTTGTTGG - Intergenic
1067077836 10:43198180-43198202 ACGGGTCCATGTGATGCTGTGGG + Exonic
1067355004 10:45516060-45516082 TCTCATTCATGGGATGGGGTAGG - Intronic
1070489331 10:76961576-76961598 TCTGTAGCATGTGATGCTGTTGG - Intronic
1070883653 10:79871050-79871072 TCTGGATCATGCTATGCTGCTGG - Intergenic
1072735684 10:97877755-97877777 TCTGTGTCATGTGATCCTGTTGG - Intronic
1073069288 10:100783047-100783069 TCTGCTGCATGGGCTCCTGTGGG + Intronic
1074550385 10:114437137-114437159 TTGAGTTCATGGGAGGCTGTGGG - Intronic
1076838776 10:133034354-133034376 TCTGGGCCTTGGGATTCTGTGGG - Intergenic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1080944513 11:36956526-36956548 CCTGCTTCATGGGATGCTGAAGG + Intergenic
1084506275 11:69570314-69570336 TGTGGGTTAGGGGATGCTGTAGG + Intergenic
1089774388 11:120826303-120826325 TCTGATACATGGGATGGTCTCGG - Intronic
1090914919 11:131154890-131154912 ACAGGATCCTGGGATGCTGTGGG + Intergenic
1093474979 12:19544759-19544781 TCTGGTTAATGGGATAATCTAGG + Intronic
1093877081 12:24361451-24361473 CCTGTTTCATGGGGTACTGTAGG + Intergenic
1094311234 12:29086391-29086413 CCTAGTGAATGGGATGCTGTAGG - Intergenic
1096996446 12:55841130-55841152 TCTGGTTGAAGGGATCCTCTAGG + Exonic
1097642399 12:62198142-62198164 TCTGCTTTATGAGATGTTGTGGG - Intronic
1098158954 12:67629411-67629433 TCTGGCTAATGGGAAACTGTCGG + Intergenic
1098640269 12:72830546-72830568 TCTGGCTCCTAGGATGCTGATGG + Intergenic
1100437419 12:94584360-94584382 TCTGGTTCTGGGGAGGCTGCGGG - Intronic
1101270111 12:103133751-103133773 TGTGGTGGAAGGGATGCTGTGGG + Intergenic
1101430392 12:104621943-104621965 TCTGGAAAATGGGATGCTGATGG + Intronic
1101765692 12:107697130-107697152 CCTCCTTCATGGGGTGCTGTGGG - Intronic
1103736694 12:123065209-123065231 TCTGGTTTTTTGGATGCTCTCGG - Intronic
1104423721 12:128657837-128657859 TCTGTTTCCTGGGATGAAGTTGG + Intronic
1104935238 12:132360900-132360922 ACTGGTTCCTCGGAGGCTGTCGG - Intergenic
1106570033 13:30918455-30918477 TCTGTTTCATGCCATGATGTTGG + Intronic
1108392215 13:49957568-49957590 TGAGGTACATGGGGTGCTGTAGG + Intergenic
1109456325 13:62596241-62596263 TCTGGTTTATGAAATGTTGTGGG + Intergenic
1109839752 13:67906195-67906217 CGTTGTTCATGGGATGCTTTGGG - Intergenic
1111311410 13:86491459-86491481 TCTGATTCATTGGAAGCAGTGGG - Intergenic
1112021855 13:95378795-95378817 TCTGGGCCATGGGTTGCTGTTGG + Intergenic
1113198473 13:107837382-107837404 TCTGATTCATGGGATGGCGTTGG + Intronic
1113198569 13:107838261-107838283 TCTGATTCATAGGATGGAGTTGG - Intronic
1113928031 13:113952050-113952072 TCTGGTTCCTTGGGGGCTGTCGG - Intergenic
1114802988 14:25799461-25799483 TCTGCACCATGGGATGCTGATGG + Intergenic
1114998976 14:28398239-28398261 ACTGGTAAATGGGATGCTTTGGG - Intergenic
1118045548 14:61967320-61967342 TCTGGGTAATGGGATGCCATTGG + Intergenic
1119905961 14:78302200-78302222 TCTATTTTATGGGATGTTGTAGG - Intronic
1121441596 14:93953161-93953183 CCTGGCCCATGGGATGCAGTTGG + Intronic
1121693699 14:95895688-95895710 TCTGGTGCATAGGGTGCTGGGGG - Intergenic
1121883152 14:97518197-97518219 GCTGGATCATAGGATGCTATTGG + Intergenic
1122317917 14:100836512-100836534 CCTGGCTGATGGCATGCTGTGGG + Intergenic
1124349916 15:28947650-28947672 TCTGGTTCCCAGGAGGCTGTGGG - Intronic
1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG + Intergenic
1128207453 15:65865858-65865880 TCTGCTTTATGGGATACTGACGG + Intronic
1129466958 15:75729502-75729524 GCTGGCTCTTGGGAGGCTGTGGG + Intergenic
1131669278 15:94601952-94601974 TCCCGTTCCTGGGATGCTGTGGG + Intergenic
1132278958 15:100596004-100596026 ACTGGCACATGGCATGCTGTCGG - Intronic
1132867952 16:2103142-2103164 TCTGTTTCATGGGCTGCTGGGGG - Intronic
1134054753 16:11162865-11162887 TCTGCAGCATGGGATGCTGCAGG + Intronic
1134523816 16:14929972-14929994 TCTGTTTCATGGGCTGCTGGGGG + Intronic
1134549087 16:15130963-15130985 TCTGTTTCATGGGCTGCTGGGGG - Intronic
1134711407 16:16328457-16328479 TCTGTTTCATGGGCTGCTGGGGG + Intergenic
1134955422 16:18380236-18380258 TCTGTTTCATGGGCTGCTGGGGG - Intergenic
1135410782 16:22232855-22232877 TTAGGTTTATGGGATGCTGAGGG - Intronic
1135514228 16:23116320-23116342 TCTGGTTTATGGGCTGCTGCTGG + Intronic
1136284695 16:29233951-29233973 CCTGCTTCCTGGGCTGCTGTGGG - Intergenic
1138460603 16:57145596-57145618 TCTGGCTGATGGGCTGCTCTGGG - Intronic
1138566054 16:57833580-57833602 TCTGGGTCCTGGGAGTCTGTGGG - Intronic
1139331091 16:66190762-66190784 TCTGGGTCCTAGGATGCTGGTGG - Intergenic
1139519560 16:67473025-67473047 GCTGGTTCCTGGAAGGCTGTGGG - Intronic
1140283174 16:73574349-73574371 TCTGATTCAGTGGATGCTGGGGG - Intergenic
1140516002 16:75542387-75542409 GCTGGACCATGGGATGCTGGAGG + Intronic
1142492061 17:285799-285821 TCGGGTTGATTGGAAGCTGTAGG - Intronic
1142928219 17:3259702-3259724 TCTGGTGGATAGGATGCTCTTGG - Intergenic
1143399226 17:6631172-6631194 TTTGGTTCATTGGTTTCTGTTGG - Intronic
1147984080 17:44294491-44294513 TATGATTCATAGGATGCTTTGGG - Intergenic
1150362059 17:64544342-64544364 TCTGTTTCATGTGATGGAGTGGG - Intronic
1151215863 17:72575921-72575943 TCTGCCTCATGGGATGCATTTGG - Intergenic
1153738929 18:8102329-8102351 TCTATAGCATGGGATGCTGTTGG + Intronic
1153944160 18:10004127-10004149 TCTGGAGCATGGGCTGCAGTGGG - Intergenic
1157743593 18:50115225-50115247 ACATGCTCATGGGATGCTGTTGG - Intronic
1158218379 18:55124281-55124303 TTTGTCTCCTGGGATGCTGTGGG - Intergenic
1158478077 18:57798056-57798078 TCTGCTTCATGGAAGTCTGTGGG - Intronic
1161199195 19:3005218-3005240 GCTGATTCATAGGAAGCTGTGGG - Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163555507 19:17990168-17990190 TCTGATCCATGGGATCATGTAGG + Intronic
1164390310 19:27814041-27814063 TATGCTCCATGGGAAGCTGTTGG - Intergenic
1165429908 19:35766761-35766783 GCTGGTGCCGGGGATGCTGTAGG - Exonic
1166040995 19:40202833-40202855 TCTGGTACATGGGATGTAGGAGG - Intronic
1166512603 19:43419677-43419699 ACTGGTTCAGGCCATGCTGTGGG - Intergenic
1168122183 19:54257624-54257646 TCTGATTCATGGGGTGGAGTGGG + Intronic
1168197553 19:54786817-54786839 TCTGGATGATGGGACGCTGGTGG - Intronic
1168481484 19:56723912-56723934 TCTGTTTCATGTGATTCTCTTGG - Intergenic
1168484134 19:56746643-56746665 TCTGCTTCATGTGATTCTCTTGG - Intergenic
925365445 2:3308221-3308243 CCTGGTTCATGGGAAACTCTGGG - Intronic
926624523 2:15080069-15080091 TCTGGCTCATGGGATGAGGGTGG - Intergenic
927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG + Intronic
928082033 2:28320210-28320232 ACTGGGTCCTGGGCTGCTGTCGG - Intronic
929633640 2:43493147-43493169 TCTGGTTCATAGCATGCAGTGGG - Intronic
929869538 2:45746680-45746702 TAATGTCCATGGGATGCTGTGGG - Intronic
933646363 2:84815884-84815906 TCTTGTTCATGGGATGTTCATGG + Exonic
935582139 2:104765568-104765590 ACTGGAGCATAGGATGCTGTGGG + Intergenic
936109224 2:109651268-109651290 CCTGGCTCATGGCATCCTGTAGG + Intergenic
936664718 2:114581043-114581065 TCTGATTCATCTGATTCTGTAGG + Intronic
936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG + Intergenic
937631114 2:124102112-124102134 TCTGGTTCAGGGGGTGGTGGAGG - Intronic
940252171 2:151691031-151691053 TCTGGTTGCTGAGTTGCTGTAGG - Intronic
944302854 2:198144116-198144138 TATGTTTCATGCCATGCTGTGGG + Intronic
945279301 2:208020519-208020541 TCTGTTTCATTGGCTACTGTGGG - Intronic
946003274 2:216500963-216500985 TCTTTTTCATGGGATGGGGTAGG + Intronic
947178569 2:227391737-227391759 TGTTGTTCGTGGGATGCTATAGG + Intergenic
948062163 2:235050043-235050065 TCTGCTTCATGGGGGGCTCTGGG + Intronic
948352858 2:237355056-237355078 TCTGGTTCTTGGCACGATGTGGG - Intronic
1169839698 20:9921445-9921467 TGTGGTTCATCTGATGCTCTAGG - Intergenic
1170982554 20:21228397-21228419 TCATGTTCATAGGATGCTCTTGG - Intronic
1172025157 20:31943381-31943403 CCTGGTTCCGGGGATACTGTTGG + Exonic
1172235565 20:33370797-33370819 TCTCTGTCATGGAATGCTGTGGG - Intronic
1172605085 20:36208607-36208629 TCTGGTTCTAGGGATTCAGTGGG - Intronic
1176073661 20:63238989-63239011 TCTGGATCCTGTTATGCTGTGGG + Intronic
1178375929 21:32067531-32067553 TCTGGTTTATGGCAGCCTGTAGG - Intergenic
1180141810 21:45897763-45897785 TGTGGGTCCTGGGCTGCTGTGGG + Intronic
1180164957 21:46020480-46020502 TCTGCTACATGGGGTGCTGGCGG - Intergenic
1181039239 22:20184178-20184200 TGTGGTTCATGGGGGACTGTGGG - Intergenic
1181039292 22:20184349-20184371 TGGGGTTCATGGGAGCCTGTGGG - Intergenic
1181360433 22:22330108-22330130 TCGGGTTCATTTGATGCTGGAGG + Intergenic
1182003457 22:26939871-26939893 TCTGGTTCCTGGGCTGCCCTGGG - Intergenic
1182280725 22:29216511-29216533 TCACGTTCATGTGCTGCTGTGGG - Intronic
1183193086 22:36334359-36334381 TCTGTTCCCTGGGATGCTGGTGG - Intronic
1183946110 22:41326683-41326705 TCAGGTTCATGAGATCCTGTGGG + Intronic
1184121209 22:42451719-42451741 TCTGCTTCAGGGGATGGTGTGGG - Intergenic
1184208761 22:43023062-43023084 CCTGCTTCATGGGGTGCTGCTGG + Intergenic
1203248778 22_KI270733v1_random:96235-96257 TATGCTCCATGGGAAGCTGTTGG + Intergenic
954108385 3:48421167-48421189 CCTGCTTCAGGGGATGCGGTGGG - Intronic
957254988 3:77825445-77825467 ACAGGTTCATGGGCTGGTGTGGG - Intergenic
963042402 3:141079329-141079351 TCTGTTTTGTGGGATGCTGTGGG - Intronic
963207349 3:142650475-142650497 TCTGATTCAGGGGATCATGTGGG + Intronic
964400330 3:156291417-156291439 TGTGGTCCAGGGGATGCTGGCGG + Intronic
965831048 3:172789575-172789597 TCTGTAGCATGCGATGCTGTTGG + Intronic
965981090 3:174691653-174691675 TCTGTAACATGCGATGCTGTTGG + Intronic
968609128 4:1549210-1549232 TCCTGTTCTTGGGATGCTGGCGG + Intergenic
969026813 4:4179814-4179836 CATGGTTAATGGGATGCTTTGGG + Intergenic
969586729 4:8098143-8098165 GCTGGGTCAGGGGAGGCTGTGGG - Intronic
970823493 4:20247768-20247790 TTTTGTTCATGGGATACTGTAGG + Intergenic
971332968 4:25697664-25697686 TCTGCCTCATGGGTTGTTGTGGG + Intergenic
974406074 4:61472132-61472154 CATGGTTCATATGATGCTGTGGG + Intronic
975599788 4:76087132-76087154 TCTGGTTGATGGGCTGAGGTGGG + Intronic
976386202 4:84461492-84461514 GCTGGGTCATGGAATGCTATGGG - Intergenic
982216906 4:153090575-153090597 TCTGGCTGATGGGATGCAGGTGG - Intergenic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
984140118 4:175994789-175994811 TCTGTAGCATGTGATGCTGTTGG + Intronic
985104659 4:186488738-186488760 CCAGGTTCAGGGGATGCGGTTGG - Intronic
986503861 5:8429678-8429700 AATGGTCCATGGGAAGCTGTGGG + Intergenic
987882170 5:23762350-23762372 TCTGCTTTGTGGGATGCTGGTGG - Intergenic
988246606 5:28691504-28691526 TCTCTTTCCTGGGATGATGTGGG - Intergenic
988488629 5:31688626-31688648 TCTGGGTCCTGGGGTGCTGAGGG + Intronic
988868416 5:35361005-35361027 TTTTCTTCATGTGATGCTGTTGG - Intergenic
990532771 5:56690080-56690102 TCAGCTTCATGGGAGGCTGGGGG - Intergenic
994153199 5:96473642-96473664 TGTGGCCCATGGGATGCTATTGG - Intergenic
994155542 5:96499650-96499672 TCTGGACTATGTGATGCTGTTGG + Intergenic
994539434 5:101076068-101076090 CCTGGTACATCAGATGCTGTTGG - Intergenic
997643298 5:135463891-135463913 TCTGGTTCATCAGAGGCTGAAGG + Intergenic
1000126710 5:158252419-158252441 TCTGGTTTATGGGCTGCAGAAGG + Intergenic
1003996047 6:11540252-11540274 TCTGTAGCATGGGATGCTGTTGG + Intronic
1009666564 6:66689031-66689053 TGTGGTTCCTGGTATGCTGAAGG - Intergenic
1011300261 6:85865962-85865984 TCTGTTTCCTGGGGGGCTGTTGG + Intergenic
1012241744 6:96880562-96880584 CCTGGGTGATGGGATGCTGATGG - Intergenic
1014703666 6:124720752-124720774 CCTGGTTCCTGGGATCCTCTGGG - Intronic
1021275321 7:18642797-18642819 TCTGGTTCCTGTGATGAGGTGGG + Intronic
1022046875 7:26628592-26628614 ACTGGATCATCTGATGCTGTTGG - Intergenic
1022492291 7:30830306-30830328 TCTGCTTCATGTGTTGCTATGGG - Intronic
1029245501 7:99196721-99196743 TCTGGTGGTTGGGAGGCTGTTGG - Intronic
1030070062 7:105690447-105690469 TCTCATTCATGTGATGCTGGGGG + Intronic
1031954877 7:127932599-127932621 TCTGTAGCATGGAATGCTGTGGG - Intronic
1033363886 7:140656872-140656894 TTTGGTTCCTGGGGGGCTGTTGG - Intronic
1035332878 7:158107788-158107810 GCATGTTCATGGGCTGCTGTGGG - Intronic
1035417174 7:158699483-158699505 TGTGTTTCATGGGATCCTGGTGG - Intronic
1035877738 8:3210075-3210097 CCTGCATCATGGGATGCAGTTGG - Intronic
1036283350 8:7420415-7420437 ACTGCTTCATTGGATGCTGCTGG + Intergenic
1038678162 8:29642423-29642445 TCTGGTTATTGACATGCTGTTGG - Intergenic
1040291201 8:46125941-46125963 TCTGGTTCCTTGGGGGCTGTTGG - Intergenic
1040483627 8:47850106-47850128 CCTGGTTCTAGGGATGCAGTAGG - Intronic
1044327149 8:90871709-90871731 TCTGGTTCATGGGATGCTGTAGG - Intronic
1044462294 8:92459555-92459577 TATGGTTCATTGTATGCTTTGGG + Intergenic
1047470063 8:125161959-125161981 TGTGGTTCTTGGAGTGCTGTTGG + Intronic
1050430999 9:5561760-5561782 TCTGGTTCATGGGCTGGTGCTGG - Intronic
1052574134 9:30269566-30269588 TTTAGTTCATGAAATGCTGTGGG + Intergenic
1053280525 9:36817505-36817527 TCTGGATCATGGGGTCCTGGGGG + Intergenic
1053510122 9:38680626-38680648 ACTTGTTGATGGGTTGCTGTGGG + Intergenic
1057217115 9:93235186-93235208 GGTGGTGCATGGGGTGCTGTGGG + Intronic
1057442482 9:95092173-95092195 TCTGGTTCCTTGTAAGCTGTTGG - Intergenic
1058137711 9:101325781-101325803 TCTGGTTTAAGGGATGCTGCTGG + Intergenic
1058695691 9:107557357-107557379 TGTGGCTTATGGGAAGCTGTGGG + Intergenic
1059138479 9:111830090-111830112 TTTGGTTGGTGGGATTCTGTGGG + Intergenic
1060374484 9:123106245-123106267 ACAGGTGCATGGGATCCTGTGGG + Intergenic
1061797973 9:133099255-133099277 TCTGGTTTATAGCAGGCTGTGGG - Intronic
1203465178 Un_GL000220v1:79483-79505 TATGCTCCATGGGAAGCTGTTGG + Intergenic
1192678353 X:73224327-73224349 TCTGATTCATTGGGTTCTGTTGG + Intergenic
1193082003 X:77415365-77415387 TCTGGGTCAGGGGATGCTACTGG + Intergenic
1195900988 X:109797031-109797053 TTTTGTTCATGGGATCCTCTAGG - Intergenic
1197409421 X:126097257-126097279 TCTGGTACATGAGCTGCAGTTGG + Intergenic
1199082871 X:143595706-143595728 TCTGATTCATGGCAGGCTGGCGG + Intergenic