ID: 1044333073

View in Genome Browser
Species Human (GRCh38)
Location 8:90944088-90944110
Sequence ACATCCAGCTTAGAAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044333068_1044333073 28 Left 1044333068 8:90944037-90944059 CCACTGTGCCTATCCTCTTGTCT 0: 1
1: 1
2: 6
3: 125
4: 1125
Right 1044333073 8:90944088-90944110 ACATCCAGCTTAGAAGGAACTGG No data
1044333070_1044333073 15 Left 1044333070 8:90944050-90944072 CCTCTTGTCTTCACAGCAATAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 1044333073 8:90944088-90944110 ACATCCAGCTTAGAAGGAACTGG No data
1044333069_1044333073 20 Left 1044333069 8:90944045-90944067 CCTATCCTCTTGTCTTCACAGCA 0: 1
1: 0
2: 2
3: 28
4: 270
Right 1044333073 8:90944088-90944110 ACATCCAGCTTAGAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044333073 Original CRISPR ACATCCAGCTTAGAAGGAAC TGG Intronic
No off target data available for this crispr