ID: 1044335186

View in Genome Browser
Species Human (GRCh38)
Location 8:90974387-90974409
Sequence CCATTGGCTTGGAGCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044335186 Original CRISPR CCATTGGCTTGGAGCTCAGC TGG (reversed) Intronic
900183220 1:1321474-1321496 TCATTGGTTTGCAGCTCTGCTGG - Intronic
900314997 1:2052004-2052026 CTTTTGGCCTGGAGGTCAGCAGG + Intronic
900560290 1:3301833-3301855 CCAATGGCTGGGAGCTCCTCTGG - Intronic
900880031 1:5374242-5374264 CCCTGGGCTTTAAGCTCAGCTGG + Intergenic
902203104 1:14848580-14848602 CCTTTGTTTTGGAGTTCAGCGGG + Intronic
903029923 1:20456634-20456656 CCATTGGGCTGGAGCTCCTCGGG - Intergenic
903168573 1:21538227-21538249 CCAAGGGCATGCAGCTCAGCAGG - Intronic
903797514 1:25940902-25940924 GCATTGGGGTGGAGCTCAGAAGG + Intergenic
904274521 1:29371573-29371595 CCATGGGCTGGGTGCTGAGCTGG + Intergenic
904521964 1:31102523-31102545 CCACTGGCCTGAATCTCAGCAGG + Intergenic
905509290 1:38505869-38505891 ACATTGGCTTAGAGCTCAGAGGG - Intergenic
906637292 1:47417625-47417647 CCAAAGGCTTGGAACTCACCAGG - Exonic
908983857 1:69992675-69992697 CCACAGACTTGGAGCTGAGCAGG + Intronic
911821919 1:102434551-102434573 CCATTGGCTTGGAGAGCATATGG + Intergenic
912585165 1:110756688-110756710 CTGTTGGCTGGGAGCTCAGCTGG + Intergenic
913533207 1:119747742-119747764 CCATTGGCGGGGAGCAGAGCTGG - Intergenic
914869608 1:151461865-151461887 CTGTTGGCTTGGACCGCAGCTGG + Intergenic
915050243 1:153062565-153062587 CCACTGCCTTGGAGATCAGGAGG - Intergenic
916197940 1:162242480-162242502 CCATCAACTGGGAGCTCAGCTGG - Intronic
916681240 1:167107110-167107132 CTGTTGGCTGGGAGCTCAGCAGG + Intronic
917241360 1:172951981-172952003 CTGTTGGCTGGGAGCTCAGCTGG + Intergenic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
917708239 1:177656775-177656797 ACATTGACTTTGAGCTCCGCTGG - Intergenic
919682392 1:200448634-200448656 CCATTGCCTTGGGCCCCAGCTGG + Intergenic
919811452 1:201411413-201411435 CCTTGTGCTTGGAGCCCAGCAGG + Exonic
920440904 1:205979775-205979797 ACATTGGCATGGACCTGAGCAGG + Intronic
920895489 1:210044753-210044775 CAATTGGCTTACAGCTCTGCAGG + Intronic
921317870 1:213909067-213909089 CCCTTGCCTGGGAGCTCATCAGG + Intergenic
921601598 1:217112023-217112045 CCGTTATCTTGGAGCTCAGGTGG - Intronic
922876283 1:228942317-228942339 CCATTGCCTGAGAGCACAGCAGG + Intergenic
1063279291 10:4607786-4607808 CCATGGCCTGGGTGCTCAGCTGG - Intergenic
1063408590 10:5819047-5819069 CCATCGGCTGGGAGCTCAGCTGG + Intronic
1064170043 10:13023390-13023412 CCATTGACTGGGGGCTTAGCTGG + Intronic
1065088701 10:22207595-22207617 CTGCTGGCCTGGAGCTCAGCTGG + Intergenic
1067220498 10:44340724-44340746 CCATCTGCTGGGACCTCAGCTGG - Intergenic
1067770949 10:49124772-49124794 ACATAGGCTTGGAGCCAAGCTGG + Intergenic
1068122777 10:52800949-52800971 CCAGAGGCTGGTAGCTCAGCTGG - Intergenic
1070603973 10:77885594-77885616 CCATTTGCAGGGAGCTCTGCAGG + Intronic
1071571698 10:86700739-86700761 CTAGTGGCTTACAGCTCAGCAGG - Intronic
1071716954 10:88106717-88106739 CCATTGGCTTGGAGGCCTGTAGG - Intergenic
1073447534 10:103590426-103590448 CCACTGGCTTGTTCCTCAGCTGG - Exonic
1075746992 10:124734911-124734933 CCCTTGGCTTGGAGGACAGAGGG - Intronic
1076207916 10:128617916-128617938 CCATTGGCTAAGACCTCAGCAGG - Intergenic
1080109371 11:28548102-28548124 CCACTGGCTTGGAGCTCACTGGG + Intergenic
1080200355 11:29662212-29662234 CTATCAGCTAGGAGCTCAGCAGG - Intergenic
1081117588 11:39223270-39223292 CCATTCGCTTAGAGCCCAGTGGG + Intergenic
1083847670 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG + Intronic
1086936714 11:92753227-92753249 CTATTAGCTGGGACCTCAGCTGG - Intronic
1087195003 11:95296430-95296452 CCACTGGCCTGTAGCCCAGCAGG + Intergenic
1089119358 11:116122874-116122896 CCACTGGCCGGGAGCTCAGTGGG + Intergenic
1089587649 11:119520432-119520454 CCATGGGCTTGGGCCTCTGCTGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1090852039 11:130579168-130579190 CCATCTGCTTGGAGCTCTGCTGG - Intergenic
1090930576 11:131294830-131294852 CAACTGGCTTGGAGGACAGCAGG + Intergenic
1091042618 11:132296201-132296223 TTATGGGCCTGGAGCTCAGCAGG + Intronic
1092311977 12:7367424-7367446 CCATTGGATTTTAGCTCAGAGGG - Intronic
1094798158 12:34000464-34000486 CTCCTGGCTTGGAGATCAGCTGG - Intergenic
1095110923 12:38294552-38294574 CTCCTGGCTTGGAGATCAGCTGG - Intergenic
1095417090 12:41988957-41988979 CCTTTAGCTGGGAGCTCAGCTGG + Intergenic
1095785722 12:46106790-46106812 CAATTGGCTGCCAGCTCAGCTGG - Intergenic
1097197139 12:57249226-57249248 CCATTGGCCTGGGGCTCTGGGGG + Exonic
1097980612 12:65734358-65734380 CTATTGGTTGGGAGCTCAGATGG + Intergenic
1099960264 12:89390419-89390441 CAGTTGGCTTGGACCTCTGCGGG + Intergenic
1100079363 12:90828812-90828834 ACATTGGCCTAGAGCTGAGCAGG + Intergenic
1100214255 12:92431303-92431325 CTCTTGGCTGGGAGCTCAGCTGG + Intergenic
1100778444 12:97997865-97997887 CCAGTGCCTTGGAGCTTATCGGG - Intergenic
1102485623 12:113253553-113253575 CCCTTGGCTGGGTGCTCAGCTGG + Intronic
1105624463 13:22099500-22099522 TCATTGCCTTCAAGCTCAGCAGG - Intergenic
1106053058 13:26209552-26209574 CCATTAGCTTGGATCTGATCAGG - Intronic
1106566514 13:30889191-30889213 CCATTGGCTTGAGGCTGTGCAGG + Intergenic
1106912477 13:34477611-34477633 TCATTGGCATGGAGCTAGGCAGG - Intergenic
1108267143 13:48723211-48723233 CTGTTGTCTGGGAGCTCAGCAGG - Intergenic
1110573625 13:77032048-77032070 CTGCTGGCTGGGAGCTCAGCGGG - Intergenic
1112409754 13:99152858-99152880 CTATTGGCTGGAAGCTCCGCTGG - Intergenic
1112571480 13:100597466-100597488 CTATTGGCTGTGAGCTCATCTGG - Intergenic
1112626725 13:101113321-101113343 CCTTTGGCCTAGAGCTCACCTGG + Intronic
1112996511 13:105580861-105580883 CTGTTGGCTGGGAACTCAGCCGG - Intergenic
1114492780 14:23113737-23113759 TCACTGGCTTGGAGCACGGCAGG + Intergenic
1115613446 14:35070622-35070644 CCATTAACTTGTAGCTCCGCCGG - Intronic
1117414097 14:55477875-55477897 CTGTTGGCTGGGAGCACAGCTGG - Intergenic
1118351102 14:64972681-64972703 CCAGTGGCTGGTACCTCAGCTGG + Intronic
1119102327 14:71891391-71891413 CTGTTGGCGAGGAGCTCAGCTGG + Intergenic
1121346434 14:93139398-93139420 CCATTGACTGGGGGCACAGCAGG + Intergenic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121500431 14:94431545-94431567 TCATTGGCTTGCAGTTCCGCAGG - Intergenic
1122913802 14:104846732-104846754 CCATCGGCTGGGGGCCCAGCTGG - Intergenic
1123159856 14:106267923-106267945 GCATTTTCTTGGAGCTCAGGTGG - Intergenic
1123173411 14:106395972-106395994 CCCTTTTCTTGGAGCTCAGGTGG - Intergenic
1123977755 15:25569127-25569149 CAATATGCTGGGAGCTCAGCTGG - Intergenic
1125111326 15:36038334-36038356 CCATAATCTTGAAGCTCAGCAGG - Intergenic
1125300947 15:38252833-38252855 CCACTGGGGTGGAGCGCAGCGGG - Exonic
1125722553 15:41852202-41852224 CCAGGGGCTAGGAGCACAGCTGG - Exonic
1126344403 15:47677267-47677289 TTATAGGCTGGGAGCTCAGCTGG + Intronic
1135589543 16:23695215-23695237 ACATTGCCCTGGAGCTCTGCCGG - Exonic
1135815174 16:25625932-25625954 CCATTGGATTGGGCCTCATCAGG + Intergenic
1136596858 16:31256687-31256709 CCGTGGGCTAGGAGCTCAGTTGG - Intergenic
1136870445 16:33802762-33802784 CCATGGAGTTTGAGCTCAGCTGG + Intergenic
1139657281 16:68396595-68396617 CCCTGTGCTTGGAGCTCAGGGGG - Intronic
1141194866 16:81852860-81852882 CTGTTGGCTGGGGGCTCAGCTGG + Intronic
1141781774 16:86167258-86167280 CTGTTGGCTGGGAGCTCGGCTGG - Intergenic
1203101727 16_KI270728v1_random:1313288-1313310 CCATGGAGTTTGAGCTCAGCTGG - Intergenic
1144197833 17:12912575-12912597 CCATTGTATTGGAGCTCAATGGG - Intronic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1152204452 17:78967147-78967169 CCAGCGGTTTGGAGCTGAGCAGG + Intergenic
1153825633 18:8871597-8871619 CTGTTGGCTGGGAGCCCAGCTGG - Intergenic
1157440212 18:47705714-47705736 TCATTGGCTTGCAGTTCTGCAGG + Intergenic
1158406342 18:57163121-57163143 CTATTGCCTGGGAGCTCAGCTGG - Intergenic
1158592405 18:58788842-58788864 CTATTGGCTGGGAGTTCAGCTGG + Intergenic
1162548678 19:11346295-11346317 CGATTGGCTTCGGGCTCAGCTGG - Intronic
1162882233 19:13668298-13668320 ACATTGGCTTCAGGCTCAGCTGG + Intergenic
1163368202 19:16888007-16888029 CCATTGGATGGGGGCTCATCGGG - Intergenic
1165002036 19:32772176-32772198 CTTTTGGCTGGGACCTCAGCTGG + Intronic
1165422140 19:35727577-35727599 CCACCACCTTGGAGCTCAGCAGG - Exonic
1165457919 19:35925543-35925565 CTGTTGGTTTCGAGCTCAGCTGG - Intergenic
1168092891 19:54097117-54097139 GCCATGGCTGGGAGCTCAGCCGG - Exonic
1168267161 19:55229321-55229343 CAGTTGGCTTGGAGGTCACCTGG - Intergenic
926036197 2:9637825-9637847 CCATGTGCTTGGTGCTGAGCTGG - Intergenic
926534078 2:14088273-14088295 CCCTTAGCTTGGTGGTCAGCTGG - Intergenic
932110518 2:68995082-68995104 CTGTTGGCTGGAAGCTCAGCTGG - Intergenic
932388334 2:71359455-71359477 CCATAGGCTGGGAGCCCAGATGG - Intronic
932707752 2:74039759-74039781 CTGTTGGCTGGGACCTCAGCTGG + Intronic
932888856 2:75572733-75572755 CTGTTGGCTGGGAGCTCAGCTGG - Intergenic
934490674 2:94760429-94760451 CCCAGGGCTTGGAGCCCAGCGGG + Intergenic
935876203 2:107510915-107510937 CCATGGGCTTGGGGCTCTGTGGG + Intergenic
937121290 2:119441508-119441530 CCAATGGCTAGGAGCTCTCCTGG + Intronic
937166937 2:119828173-119828195 CTGTTGGCTGGGAGGTCAGCTGG - Intronic
937366231 2:121264086-121264108 ACATAGGCTTGGGGCTCAGGAGG + Intronic
938711852 2:133981860-133981882 ACATAGGCTGGGAGCCCAGCAGG + Intergenic
940771949 2:157848408-157848430 CTGTTGGCTGGGAGCTCAGCTGG - Intronic
944913720 2:204335994-204336016 TCATTGGTTTGGAGAGCAGCAGG - Intergenic
945265384 2:207886228-207886250 CCGTGGGCTTGGGGCTCATCTGG - Intronic
946452904 2:219796282-219796304 CTGTTGGCTGGGAGCTCAGCTGG - Intergenic
947148189 2:227087666-227087688 ACATTGGCTGGGAGATGAGCTGG - Intronic
948457898 2:238115471-238115493 CCAGTGGCCTTGAGCTCATCTGG - Intronic
1170361284 20:15548888-15548910 CTATTGGCTGGGAGCTCAGCTGG - Intronic
1170747387 20:19112661-19112683 CCATTGCCTGGGAGCTCCTCTGG + Intergenic
1170926481 20:20729322-20729344 CTGTTGGCTTGAAGCTCAGCTGG + Intergenic
1171311504 20:24148816-24148838 CAGTTGGCTGGGACCTCAGCTGG + Intergenic
1171976338 20:31597048-31597070 CCATTTGCCTGGAGCTCTGGAGG + Intergenic
1172200169 20:33120292-33120314 CCACTGTTTAGGAGCTCAGCTGG + Intergenic
1177896676 21:26861459-26861481 CCATTGCCTGAGAGCACAGCGGG + Intergenic
1178906082 21:36637979-36638001 CAATTGGGTTGCAGCTCATCTGG - Intergenic
1179173813 21:38992703-38992725 TCTTTTGTTTGGAGCTCAGCGGG - Intergenic
1181366602 22:22381346-22381368 CCATTGGCCTGGAGCACTGTGGG - Intergenic
1182109981 22:27716197-27716219 CTGTTAGCTGGGAGCTCAGCAGG + Intergenic
1182549317 22:31092472-31092494 CCACTAGCCGGGAGCTCAGCCGG + Intronic
1184136588 22:42553695-42553717 CCACCGGCTTGGAACCCAGCAGG - Intronic
950625638 3:14244695-14244717 CCATGGGCGTGGAGAGCAGCAGG + Intergenic
951564046 3:23994844-23994866 CCATTGACTGGGAGCTCCACTGG - Intergenic
954872353 3:53777370-53777392 CCATTCTCCTGGACCTCAGCAGG - Intronic
957173136 3:76765655-76765677 CTCTTGGTTGGGAGCTCAGCTGG - Intronic
958444798 3:94202555-94202577 CCAGAGGCTGGTAGCTCAGCTGG - Intergenic
960060674 3:113317364-113317386 CTCCTGGCTTGGAGGTCAGCTGG - Intronic
960329405 3:116339782-116339804 CTCTTGGCTGGGATCTCAGCTGG - Intronic
961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG + Intergenic
962378862 3:134880689-134880711 GCATTGGCTGGGTGCTCAGAGGG - Intronic
962480876 3:135797257-135797279 CTGTTGCCTAGGAGCTCAGCTGG - Intergenic
963431414 3:145209770-145209792 CCATATGTTTGGAGATCAGCTGG + Intergenic
966532525 3:180996684-180996706 CCATTCGCTGACAGCTCAGCAGG - Intergenic
967030181 3:185598476-185598498 CCATGGGCTTTGTGGTCAGCTGG - Exonic
967249308 3:187520517-187520539 CCATTGGCTGGGAGCCCACATGG + Intergenic
968938610 4:3626362-3626384 ACATAGGCTGGGAGGTCAGCAGG - Intergenic
969456284 4:7301537-7301559 ACATTGGCTGGGAGCACGGCAGG + Intronic
969625356 4:8302157-8302179 GGGTTGGGTTGGAGCTCAGCTGG + Intronic
969890301 4:10253975-10253997 GCAGTGACTTGTAGCTCAGCTGG + Intergenic
970939295 4:21612764-21612786 CCAATGGCTTCCAGCACAGCAGG + Intronic
971333647 4:25703029-25703051 CTGTTGGCTGGGATCTCAGCTGG + Intergenic
972306103 4:37831572-37831594 CTATTGGCTGGGATCTTAGCTGG + Intronic
972424639 4:38920877-38920899 CCATTAGCGTGGAGTTCAGCAGG - Intronic
972448367 4:39169731-39169753 CTATTGGCTGGGAGCCCACCTGG - Intergenic
973679901 4:53306621-53306643 CCATTGGCTTGGTACACAGTGGG - Intronic
973912117 4:55592034-55592056 CCCTTGGCTTCGGGCCCAGCTGG + Intronic
974843107 4:67320861-67320883 ACAGTGGTTTGGATCTCAGCTGG + Intergenic
976270955 4:83229941-83229963 GCATTGCCTCGGAGCTCTGCAGG + Intergenic
976821904 4:89216151-89216173 ACTTTGGCTGGGAGCTCAGCTGG - Intergenic
986489995 5:8279651-8279673 CGGCTGGCTGGGAGCTCAGCAGG - Intergenic
987069121 5:14319148-14319170 ATATTGGCTTGGATGTCAGCAGG + Intronic
988779624 5:34508444-34508466 CTATTGGCTGGGATCTCAGTGGG - Intergenic
989151769 5:38306984-38307006 CAGTTGGCTAGAAGCTCAGCCGG - Intronic
991667899 5:69017941-69017963 CTATTGGCTGAGACCTCAGCTGG - Intergenic
991940630 5:71848965-71848987 CTGTTGGCTGGGACCTCAGCTGG + Intergenic
993460617 5:88176897-88176919 CTATTGCCTGGGAGCACAGCGGG - Intergenic
995861263 5:116643098-116643120 CCATCAGCTAGGACCTCAGCTGG - Intergenic
995958733 5:117812903-117812925 CTATTGACTGGCAGCTCAGCTGG - Intergenic
996133341 5:119809117-119809139 CTATTGTATTGCAGCTCAGCTGG + Intergenic
997276650 5:132598661-132598683 CTATTGTCTGGGAGCTCAGCTGG + Intronic
999097010 5:148988594-148988616 CAGTTGGTTGGGAGCTCAGCTGG - Intronic
999190119 5:149741087-149741109 CCACTGTCTGGGAACTCAGCCGG + Intronic
999474562 5:151886808-151886830 CCATGGCCTTGGGGCTAAGCAGG - Intronic
1000096046 5:157971616-157971638 CTGTTGGCTGGGAGCTCAGCTGG + Intergenic
1001031810 5:168268779-168268801 GCAGGGGATTGGAGCTCAGCGGG + Intergenic
1001547483 5:172579610-172579632 CCCTTGGCTGGGAGGTCAGCAGG - Intergenic
1002476336 5:179468686-179468708 CCATGGGCTGGGAGCTGAGCTGG - Intergenic
1002870841 6:1166180-1166202 TGCTTGGCTGGGAGCTCAGCTGG + Intergenic
1003152597 6:3565150-3565172 CCATTAGCTGGGAGCTCAGCTGG + Intergenic
1006580219 6:35072796-35072818 GCATTGGCTCTCAGCTCAGCAGG + Intronic
1007092917 6:39195310-39195332 CTGTTGGCTGGGAGCTCAGCTGG - Intronic
1008021770 6:46586670-46586692 TCTTTGGCTTGGAGCATAGCAGG - Intronic
1008560144 6:52715804-52715826 CTTTTGGCTAAGAGCTCAGCTGG + Intergenic
1009650216 6:66466706-66466728 GCATTGGCTTGGAAGTCAGGTGG - Intergenic
1009807700 6:68623793-68623815 CTATTGGCTGGGGGCTCAGTAGG - Intergenic
1010116514 6:72317371-72317393 CCCTTGGCCTGGAGCTTTGCAGG + Intronic
1014595915 6:123338530-123338552 CTGTTGGCTGGGAGCTCAGCTGG - Intronic
1018062716 6:160103203-160103225 TCATTGGCCTGTGGCTCAGCTGG - Intronic
1018421452 6:163643891-163643913 CCACTGCCTAGGGGCTCAGCAGG + Intergenic
1022652769 7:32292741-32292763 GGATTGGCTTGGAACACAGCAGG - Intronic
1028906886 7:96164304-96164326 CAATCAGCTTGGAGCTCAGCTGG - Intronic
1030328450 7:108247090-108247112 TTTTTGGCTGGGAGCTCAGCTGG - Intronic
1032516152 7:132507782-132507804 CCATTGGCTGTGAGCGCAGTGGG - Exonic
1034947579 7:155273269-155273291 CCATTGGCTTCTGGTTCAGCTGG + Intergenic
1036932913 8:12973589-12973611 GCATTGGCTAGGATCTCATCTGG + Intronic
1037712336 8:21364803-21364825 CCTTTGGAGTGGAGCCCAGCAGG - Intergenic
1038675721 8:29621090-29621112 AGATTGGCTGGGAGATCAGCTGG + Intergenic
1039120608 8:34142174-34142196 CTATCAGCTGGGAGCTCAGCTGG + Intergenic
1040463821 8:47675979-47676001 CCTCTGGCCTGGAGCACAGCTGG - Intronic
1042456122 8:69005663-69005685 CTCTTGGCTGAGAGCTCAGCTGG + Intergenic
1044335186 8:90974387-90974409 CCATTGGCTTGGAGCTCAGCTGG - Intronic
1046276330 8:111965015-111965037 CTACTGGCTTGGAGGTCAGCTGG + Intergenic
1048423385 8:134299424-134299446 CCATTGGCTGGCAGCACAGCTGG + Intergenic
1048557715 8:135496800-135496822 TCAGTGGCTGGGAACTCAGCTGG + Intronic
1048857439 8:138696798-138696820 CCATTGCCATTGAGCTCAGAAGG + Intronic
1050327099 9:4508386-4508408 CAACTGGCTTAGAGCCCAGCAGG - Intronic
1050469857 9:5976110-5976132 TCATGGGCTTGAAGTTCAGCTGG + Intronic
1052875907 9:33563412-33563434 CCATTGGCTGGAACCTCAGCTGG + Intronic
1052881441 9:33603093-33603115 CCCAGGGCTTGGAGCCCAGCAGG - Intergenic
1055590076 9:77803054-77803076 CCAAGGGCCTGGAGCACAGCAGG + Intronic
1055880943 9:81002461-81002483 CTGTTGGCTGGGAGCTCAGTTGG - Intergenic
1056495952 9:87155460-87155482 GTTTTGGCTGGGAGCTCAGCTGG - Intronic
1056513893 9:87332129-87332151 CCATTGCCTGGGACCTCAGCTGG - Intergenic
1059516448 9:114900371-114900393 CCATTGGTTGGAAGCCCAGCAGG + Intronic
1060051906 9:120383863-120383885 CCAGTGGCTGGGAGCCCACCTGG - Intergenic
1061805502 9:133135478-133135500 CCATTGGCTTTGAGCCCAGCAGG + Intronic
1186920959 X:14279820-14279842 CTATTGGCTGGCAGGTCAGCTGG + Intergenic
1187429539 X:19209621-19209643 CTGTTGGCTGGGAGTTCAGCTGG + Intergenic
1188568535 X:31554311-31554333 TCATTGGCTTGGGGTACAGCTGG + Intronic
1189329100 X:40132132-40132154 CTATTGGCTGGGAGCTCTGCTGG - Intronic
1189395398 X:40618089-40618111 TTATTGGCTGGGAGCTCAACTGG - Intergenic
1189559593 X:42178414-42178436 CTACTGGCCAGGAGCTCAGCTGG - Intergenic
1189728112 X:43989233-43989255 CCATTGGCTTGGGGCCTAGCTGG + Intergenic
1189728485 X:43993697-43993719 CCATTGGCTTGGGGCCTAGCTGG - Intergenic
1189958149 X:46297844-46297866 CTATTGGCTGGGAGCTCAGCTGG + Intergenic
1190017644 X:46841511-46841533 CTTTGGGCTGGGAGCTCAGCTGG + Intronic
1190039522 X:47058602-47058624 CCAATGGCCTGGAGGGCAGCTGG + Exonic
1193488263 X:82115077-82115099 CTATTGGATTGGAGCTAAGCTGG + Intergenic
1195300641 X:103526679-103526701 GCATCTGCTGGGAGCTCAGCTGG + Intergenic
1196745161 X:119065224-119065246 CGAGTAGCTTGGAGTTCAGCTGG - Intergenic
1198835890 X:140804669-140804691 CAATTTGCTTTGAGCTCAGCTGG - Intergenic