ID: 1044337145

View in Genome Browser
Species Human (GRCh38)
Location 8:90999821-90999843
Sequence AGCTATATACAATTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044337145 Original CRISPR AGCTATATACAATTTGAGGA AGG (reversed) Intronic
905248887 1:36634983-36635005 AACTATATAAAAATTGAGAAGGG - Intergenic
906123216 1:43409007-43409029 GTCTATATACAATTTTAGGATGG + Intronic
907502602 1:54893212-54893234 AGCTATGTACATTTTCAGGGAGG + Intergenic
907875891 1:58488181-58488203 ATCTATAAACAATAAGAGGATGG - Intronic
908051735 1:60240089-60240111 AGACATAAACAATTTGAAGATGG - Intergenic
909444445 1:75732744-75732766 AGGTATATACATTTTAAAGAGGG + Intronic
909622711 1:77685181-77685203 AGATATATACTATTTGTGGTAGG + Intergenic
909965874 1:81909642-81909664 ATCTGTATACTATTTGAAGATGG - Intronic
912900926 1:113647417-113647439 AGGTGTATGCAATTTGAGGGAGG + Intronic
915699640 1:157779396-157779418 AGCTATAGAAATTTTGTGGATGG + Intergenic
916675040 1:167058329-167058351 AGCTATAAACGAGATGAGGAGGG + Intronic
916908131 1:169311448-169311470 AGCTATATCCAATTTAAGTAAGG - Intronic
917070332 1:171143342-171143364 AGATACATACAGTTTGAGGTAGG + Exonic
917587386 1:176441371-176441393 GTCTATAAACGATTTGAGGATGG - Intergenic
919000011 1:191818558-191818580 AGCTCTATCCAATTTGTTGACGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
923356857 1:233165345-233165367 TGGTTTTTACAATTTGAGGAAGG + Intronic
1067547998 10:47209892-47209914 AGCTATTTACATTTTGGTGAGGG + Intergenic
1073726359 10:106235642-106235664 GGCTATATTCAATTTAGGGAGGG - Intergenic
1077732120 11:4742590-4742612 ATATATATAAAAATTGAGGAAGG - Intronic
1077951058 11:6957522-6957544 AGCTATATACACATTTAAGACGG - Exonic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1080529890 11:33164234-33164256 AGCTATATACAGGTTGAGGCTGG - Intergenic
1083126904 11:60578389-60578411 GGATATATACAATTTGTGTAGGG + Intergenic
1086570734 11:88281342-88281364 AGTTAAAAAGAATTTGAGGATGG + Intergenic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1090193605 11:124796299-124796321 TCCTTTATACAATGTGAGGAAGG + Intronic
1090830329 11:130416543-130416565 AGCTAGATCCAAATTCAGGACGG - Intronic
1091436528 12:477795-477817 AGAAATATACAAGTTGATGAGGG + Intronic
1091986865 12:4916845-4916867 AACTATACACAATGTGAAGAAGG - Exonic
1099541526 12:83914757-83914779 AGGTATATACAATTTTAACAAGG + Intergenic
1101776391 12:107798344-107798366 ACCTATAAACATTTTGAGGGGGG - Intergenic
1103588856 12:121976309-121976331 AGCCTTATAGGATTTGAGGAGGG + Intronic
1104651977 12:130541542-130541564 ATCTATATTCAATGAGAGGAAGG - Intronic
1104851191 12:131875024-131875046 ATCTGTATACAAGTTGAGGTCGG + Intergenic
1108936378 13:55886186-55886208 TGATATATATGATTTGAGGAAGG + Intergenic
1111836409 13:93393885-93393907 TGCTATATAAAAAGTGAGGAAGG - Intronic
1114584029 14:23793422-23793444 AGATTTAAACAATTTGTGGAAGG - Intergenic
1115089266 14:29554382-29554404 AGCTATAAGCAATTTGAATATGG - Intergenic
1115190754 14:30744976-30744998 AGCTGTAGACAGTTTGAGAAAGG - Intergenic
1116020087 14:39449820-39449842 AACTATATAAAGTTTGAAGAAGG - Intergenic
1116447393 14:45026479-45026501 AGCTGTAGCCAATCTGAGGAGGG - Intronic
1120105139 14:80485478-80485500 AGTTATACACAATTTGAGGTTGG - Intronic
1120913912 14:89693278-89693300 AGCTATATATTATTTGTGTAAGG + Intergenic
1121132578 14:91461831-91461853 AGGAATATACTATTTCAGGAAGG - Intronic
1125797023 15:42410563-42410585 GGCAATAGAAAATTTGAGGATGG - Intronic
1126585464 15:50281661-50281683 AGCCATAGACAATTTGAAAATGG - Intronic
1127819123 15:62639915-62639937 AGCTATCTTTAATTTAAGGAGGG - Intronic
1128032421 15:64492867-64492889 TGCTATACTCAATTCGAGGAGGG - Intronic
1130641860 15:85683949-85683971 AGCTAGGTTCAATTTTAGGAGGG - Intronic
1131938471 15:97534152-97534174 AGATATCTACATGTTGAGGATGG - Intergenic
1133664188 16:7949530-7949552 AGATATATAAAGTTTTAGGATGG - Intergenic
1137656297 16:50161191-50161213 ATATATATTCAAGTTGAGGATGG + Intronic
1137678986 16:50322267-50322289 AGCTATATACATGTTTAAGAAGG + Intronic
1139385293 16:66564886-66564908 AGCTCTAAGCAACTTGAGGACGG - Intronic
1149114977 17:53082435-53082457 AGAGATATACAATTTGAAGGTGG + Intergenic
1151922257 17:77165969-77165991 AGCTATGCACAAGATGAGGAGGG - Intronic
1153974784 18:10259185-10259207 AGCTGTAAGCATTTTGAGGATGG + Intergenic
1154290176 18:13099552-13099574 ATCTATATACACTGTGACGATGG + Exonic
1156508921 18:37618591-37618613 AGATATATAGAAGTCGAGGATGG - Intergenic
1160477459 18:79205171-79205193 AATTACATTCAATTTGAGGAAGG - Intronic
1162851125 19:13431814-13431836 AGCTCTAAAAAATTTGAGGCCGG + Intronic
1166455617 19:42937684-42937706 AGCTAGATACGATTAGAGAAAGG - Intronic
927127720 2:20028099-20028121 AGCAGTATAAAATTTGTGGAGGG + Intergenic
927420249 2:22923653-22923675 AGCTACATAGAGTTTGAGAAGGG + Intergenic
928357907 2:30637502-30637524 ATCTATTTACCATTTGAGAAAGG - Intronic
928970969 2:37029036-37029058 AGCTATATACAATTTAACTATGG + Intronic
929425107 2:41836828-41836850 ATTTACATACAATTTCAGGAGGG + Intergenic
929439740 2:41955606-41955628 AGCTCTTTTCATTTTGAGGAGGG - Intergenic
930342225 2:50131666-50131688 AGCTATTTACATTTTGCTGATGG + Intronic
932917982 2:75877652-75877674 ATCAGTATACAAGTTGAGGATGG - Intergenic
935586804 2:104807917-104807939 AGCTCAGTACAATTTGAAGAGGG - Intergenic
942781832 2:179652999-179653021 GGCTAAATACAATGTTAGGAAGG - Intronic
945156462 2:206845006-206845028 ATGTATATACAATTTAAAGAGGG - Intergenic
945201629 2:207287557-207287579 ATTCATATACAATTTGAGTATGG - Intergenic
947398308 2:229708093-229708115 AAATCTATACCATTTGAGGAGGG + Intronic
1173509329 20:43614110-43614132 AGCTATATACATTTTGCTTATGG + Intronic
1173691350 20:44963565-44963587 AGAAATCTACAATTTGAGCATGG - Intergenic
1177260238 21:18720153-18720175 AGTTACATAATATTTGAGGATGG - Intergenic
1178680024 21:34666320-34666342 TGCTTTATACCATTTGAAGAGGG + Intergenic
949333653 3:2949991-2950013 GAATATCTACAATTTGAGGAAGG + Intronic
956681089 3:71781732-71781754 AGCTATATACAAGTAAATGAAGG - Intronic
960234632 3:115267572-115267594 AGCAATTTACAACTTTAGGAAGG - Intergenic
965608187 3:170517511-170517533 GGCTGTCTTCAATTTGAGGAGGG + Intronic
966307501 3:178553202-178553224 AGATACATAAAATGTGAGGAAGG + Intronic
971905711 4:32722522-32722544 AGCCTTATCCAATGTGAGGAAGG + Intergenic
972458424 4:39276434-39276456 AGCTATAAACCATTTGTGCATGG - Intronic
974398101 4:61366525-61366547 AGCTATATACTAAGTGATGAAGG - Intronic
978402362 4:108344074-108344096 ACCTATGGACACTTTGAGGAAGG - Intergenic
980932099 4:139191942-139191964 AACTTAATACAATTTGAGGGAGG + Intergenic
983159777 4:164398056-164398078 ATCTTTATACAATTCTAGGAGGG - Intergenic
983200705 4:164857693-164857715 ATATATATATAATTTGGGGAAGG + Intergenic
986908420 5:12523254-12523276 AAATATAAATAATTTGAGGAAGG + Intergenic
988661390 5:33273471-33273493 AGATGTATACAATGTGTGGAAGG + Intergenic
989724571 5:44572798-44572820 AGCTATGTACATTTTGATAAGGG - Intergenic
989818750 5:45767999-45768021 AGCTATATACATTTAGAGGTAGG - Intergenic
990884766 5:60579035-60579057 ATCTATATACAATTTTATGGAGG + Intergenic
992012745 5:72545527-72545549 ATCTATACCCAATTTGATGAGGG + Intergenic
993088586 5:83395878-83395900 AGCTATAAGAAATTTGAGGCTGG + Intergenic
993808935 5:92450696-92450718 AGCAATATACAATTTAGGTATGG - Intergenic
995005404 5:107187688-107187710 TGCAATATACAAATTGTGGATGG + Intergenic
996663534 5:126031550-126031572 AGCTATAAACAAGTTCAGCAAGG + Intergenic
997251999 5:132396311-132396333 ATCTATATACAATTTGCACAGGG + Intergenic
1000190454 5:158905238-158905260 AACAAAATACATTTTGAGGATGG - Intronic
1000437145 5:161226085-161226107 AGCAAAATACAATTTGATGTTGG - Intergenic
1000874878 5:166624617-166624639 AGATATATACAATGTGATGTTGG + Intergenic
1003512358 6:6792069-6792091 AGGTATATAGGGTTTGAGGAAGG - Intergenic
1005674420 6:28139089-28139111 AGGTAAATACTATTTGAGGGTGG + Intergenic
1007867870 6:44993325-44993347 TACTATATCCAATTTGAAGATGG - Intronic
1007885916 6:45230139-45230161 AGCTTTATCCAGTTTGTGGATGG - Intronic
1009277591 6:61703577-61703599 ATCAATTTGCAATTTGAGGATGG - Intronic
1011111587 6:83842926-83842948 AGCTATATTCACTTTGATTATGG + Intergenic
1011278803 6:85656427-85656449 AGCTTCATCCAACTTGAGGAAGG - Intergenic
1013445221 6:110219258-110219280 TGCTTAATACATTTTGAGGAAGG - Intronic
1013868831 6:114731233-114731255 AGGTAAATACAATTTCAGAATGG + Intergenic
1013961248 6:115902988-115903010 AGCTATACACAATTTGGGGGAGG - Intergenic
1014961927 6:127696754-127696776 AGCTATCTACAATCTATGGAGGG - Intergenic
1016597590 6:145818681-145818703 GGCTATACCCAAGTTGAGGAAGG + Intergenic
1017027433 6:150193640-150193662 AGCTGTATACATCTGGAGGAGGG + Intronic
1017066428 6:150533375-150533397 AGCCATCTACGATCTGAGGAGGG + Intergenic
1017533996 6:155327184-155327206 AACTTTATTCATTTTGAGGAAGG + Intergenic
1017641878 6:156502518-156502540 AGCAATAGACAATGAGAGGAAGG - Intergenic
1018652096 6:166001049-166001071 AATTCTATACAAATTGAGGAAGG + Intergenic
1022518412 7:30989832-30989854 GGCTGGATAGAATTTGAGGAAGG + Intronic
1023599545 7:41867819-41867841 AGCAAAATACAATTTTATGAGGG + Intergenic
1023795169 7:43786340-43786362 AGATACATACAAGTTTAGGATGG - Intronic
1024466369 7:49715589-49715611 AGCTATATACAAACTGAACAAGG - Intergenic
1027807387 7:82845823-82845845 AACTATGTAAAATTTAAGGAAGG - Intronic
1027905913 7:84181131-84181153 ACATATACAAAATTTGAGGAGGG - Intronic
1029882975 7:103836258-103836280 AGCTACAAACAATATGAGGTAGG - Intronic
1030309355 7:108053907-108053929 AGCTGTATACATTTTGAAGTGGG + Intronic
1033429450 7:141275645-141275667 AGCTATTTACATTATGAGCAAGG - Intronic
1036403865 8:8436309-8436331 AGCAATATTCAATTTGAAAATGG - Intergenic
1036599228 8:10244185-10244207 AGCCATATAAAATTTGAGTGAGG + Intronic
1037060259 8:14499750-14499772 ATCTATATACAAATTGATAAGGG - Intronic
1040669468 8:49671959-49671981 AACTATATAGTATTTCAGGAGGG + Intergenic
1042381052 8:68114734-68114756 AGTTACATACAATGTGAGGATGG - Intronic
1044025057 8:87158974-87158996 GTTTTTATACAATTTGAGGAAGG + Intronic
1044337145 8:90999821-90999843 AGCTATATACAATTTGAGGAAGG - Intronic
1045884736 8:107082227-107082249 AGCACTCTACAATTTAAGGAGGG - Intergenic
1047158488 8:122349574-122349596 AGATATCTACATTTTGAGGATGG - Intergenic
1047827116 8:128588915-128588937 AGCTATTTTCAATTTGAAGAGGG - Intergenic
1050828386 9:9979541-9979563 TGATATATACAATTTAAAGATGG + Intronic
1056119853 9:83476859-83476881 ACCTAAATACAATTAGAGTAAGG - Intronic
1058063600 9:100525105-100525127 AGCTATATACAAGGTGTAGAGGG - Intronic
1062650078 9:137571164-137571186 ATATAAATACATTTTGAGGATGG - Intronic
1188077440 X:25795874-25795896 AGATATAAAGCATTTGAGGAAGG + Intergenic
1190836316 X:54104241-54104263 AGGTTGATACAGTTTGAGGAGGG - Intronic
1191166734 X:57399973-57399995 ATCAGTATACAATTTGAGGTCGG + Intronic
1193484757 X:82072937-82072959 AGATATATCCAATCTGAGGCAGG - Intergenic
1193576121 X:83198414-83198436 TGCTATATCCAATTTGCTGAAGG - Intergenic
1196514659 X:116555670-116555692 TGCTATATAAAATTAGAGGGAGG - Intergenic
1200050633 X:153428743-153428765 ATCTATAAACCATTTGAGGGAGG + Intergenic
1201635897 Y:16122904-16122926 AAGTATATACAATTTATGGAAGG + Intergenic