ID: 1044337721

View in Genome Browser
Species Human (GRCh38)
Location 8:91007208-91007230
Sequence ATCCAATAGAAGTCTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044337721 Original CRISPR ATCCAATAGAAGTCTGTACA TGG (reversed) Intronic
907529105 1:55075326-55075348 ATACAGTAGAAGTCTGGTCAGGG - Intronic
908874439 1:68655087-68655109 ATCCAATATAAGCCTTTGCAAGG + Intergenic
913324707 1:117616572-117616594 CTCCAAGAGAAGTGTGTACCTGG - Intronic
916639821 1:166715879-166715901 AACCAATAGAAACCTCTACAGGG + Intergenic
917710774 1:177681812-177681834 ATCCAATCAAAGGCTGTACTTGG + Intergenic
920062724 1:203238937-203238959 ATTAAATGAAAGTCTGTACATGG + Intronic
921106270 1:211982608-211982630 ATCAAACAGAATTCTGTCCAAGG + Intronic
1067827685 10:49590970-49590992 ATCCAACTGAAGGCTGTATATGG - Intergenic
1072548667 10:96460233-96460255 ATCCAATAGACGTATGGAGAGGG + Intronic
1079677299 11:23246133-23246155 ATACAATGGGAGTCTGTTCAGGG + Intergenic
1080452884 11:32393346-32393368 ATCCAAGAGAAGTCAGTAGTGGG + Intronic
1080486198 11:32709584-32709606 ATCCAACAGCAGGCTGTGCATGG - Intronic
1086577393 11:88355507-88355529 AGCTAATAAAAATCTGTACATGG + Intergenic
1087003623 11:93446379-93446401 ATTTAAAAGAAGTCTGTATATGG - Intergenic
1093315356 12:17643501-17643523 ACCCAAAAGAAGCCTATACATGG + Intergenic
1093929327 12:24938812-24938834 CTACAGTAGAAGTCTGCACAAGG - Intronic
1096204549 12:49709872-49709894 AACCAATAGAAGTATGGACAGGG + Intronic
1099982389 12:89620163-89620185 ATCCAAAAGAAGTCCCAACAAGG + Exonic
1100219425 12:92488210-92488232 ATTCAATAGAATTCTGTATTTGG - Intergenic
1100892818 12:99145117-99145139 CTCCAAGAGAAGTATGTACAAGG + Intronic
1101333528 12:103776737-103776759 ATCTAAGAGAAGGCTGGACATGG + Exonic
1107691207 13:42955499-42955521 ATCCAACAAAAGTCTGTTTATGG + Intronic
1110324364 13:74196940-74196962 ACCCAATAGAAGTCTGGGAAAGG + Intergenic
1111520933 13:89402796-89402818 AGCAAATAGAAGTCTTTAAATGG - Intergenic
1114964296 14:27938803-27938825 ATCAATTAGAAGTCTCTATATGG - Intergenic
1120579329 14:86226877-86226899 TTCCAAAACAAGACTGTACATGG + Intergenic
1120695935 14:87645066-87645088 GTCTTATAGATGTCTGTACATGG - Intergenic
1127015409 15:54680239-54680261 ATTCAATTGAAGTCTTTAGATGG + Intergenic
1127538774 15:59916866-59916888 ATCCAGTAGTAGTGTGTACCAGG - Intergenic
1128372910 15:67053621-67053643 TTGGAATAGAAGTCTGAACAGGG + Intergenic
1128652288 15:69426875-69426897 GACCAAAAAAAGTCTGTACATGG - Intronic
1129334099 15:74842363-74842385 AGCCAAGAAAAGTCTGAACAAGG - Exonic
1143230852 17:5353377-5353399 TTACAATACAAGTATGTACAAGG - Intronic
1149275449 17:55029745-55029767 ATTTAATAGAAGTATGTATAGGG - Intronic
1151121729 17:71800267-71800289 AGCCACTAAAAGTCTATACATGG - Intergenic
1157646918 18:49283630-49283652 ATCAAATAAAACTCTGAACATGG + Intronic
1158061238 18:53345940-53345962 ATCCAAAAGAAGTCAGGAAAGGG - Intronic
1160029364 18:75245109-75245131 ATCCACTAGAAGTCTGTAGCAGG - Intronic
1168163882 19:54533460-54533482 CTACAACAGAAATCTGTACATGG - Intronic
930978899 2:57497819-57497841 ATTCACTAGAGGTCTGTACAGGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935585675 2:104798075-104798097 TACCAATGGAAGTCTGAACAAGG + Intergenic
938028926 2:127974969-127974991 ATCCCATATAGGTTTGTACAAGG + Intronic
938311923 2:130296640-130296662 ATCCAATAGAAGTGTGTAACAGG + Intergenic
939815068 2:146885119-146885141 ACCCAACAGAAATGTGTACATGG + Intergenic
942011499 2:171766948-171766970 ATCCAAGTGAAGTCCATACATGG - Intergenic
943172509 2:184421426-184421448 ATGCAATAGAAGTCTTTAATAGG + Intergenic
943937482 2:193938908-193938930 ATCTAATAGAAGTTTCTACTTGG - Intergenic
945201105 2:207282370-207282392 ATACAATAGCAATATGTACATGG + Intergenic
1172547828 20:35775380-35775402 ATCCCTTAAAAGTTTGTACAAGG + Intronic
1180944409 22:19682712-19682734 ATCCACTAAAAGGCTGTACAAGG + Intergenic
1181642027 22:24206819-24206841 ATCCAGTAGAAATATGCACAGGG - Intergenic
1181642201 22:24208296-24208318 ATCCAGTAGAAATATGAACAGGG - Intergenic
951160224 3:19410213-19410235 ATACAATAGAAATCAATACAAGG + Intronic
955722694 3:61900432-61900454 ATCTGTTAGAAGTCTGTAAATGG + Intronic
957637418 3:82804732-82804754 ATTAAATAGAAGTCAGCACAAGG + Intergenic
958048459 3:88316010-88316032 ATACAAAAGGAGTCAGTACATGG + Intergenic
960620182 3:119629748-119629770 ATTCAATAGAAACATGTACAGGG + Exonic
962842337 3:139246721-139246743 ATCCAATAGAAGTTAGAAAAAGG - Intronic
962894346 3:139700458-139700480 ATAGAATGCAAGTCTGTACAAGG + Intergenic
964925853 3:161955851-161955873 AACCAGTAGAAATCTTTACAAGG + Intergenic
967685930 3:192416250-192416272 ATCAAATGGAAGTTTGGACAAGG + Intronic
969698693 4:8752756-8752778 CTCCACTAGAAGTTTGTAAAAGG + Intergenic
970825873 4:20273791-20273813 ATTCAAGAGAAATTTGTACATGG - Intronic
971723628 4:30280048-30280070 ATACAATAAAAGTCAGTCCATGG - Intergenic
973744838 4:53953500-53953522 ATCCAAAAGAAGAGTCTACAGGG - Intronic
976128917 4:81863433-81863455 ATCCAAAAGAAATCAGTATATGG + Intronic
976398903 4:84585886-84585908 ATTTATTGGAAGTCTGTACAAGG + Intronic
976979150 4:91204228-91204250 TAACAATAGAAGGCTGTACAGGG + Intronic
981843138 4:149135592-149135614 ATCCAATTCAAGTCTGTTAAAGG - Intergenic
986303420 5:6496699-6496721 AACCAATAAACGTCTTTACACGG + Intergenic
989242505 5:39217236-39217258 TTCAATTAGAAGCCTGTACAAGG + Intronic
989733712 5:44677705-44677727 CTACAATAAAAGTATGTACAGGG - Intergenic
991419293 5:66425139-66425161 ATCCAACAGAAGGCAGTAAAAGG + Intergenic
993467943 5:88270429-88270451 ATCCAAAAGAAGCATGCACAGGG + Intergenic
997898929 5:137745745-137745767 ATCCTAAAGAAGCCTGCACATGG - Intergenic
998680381 5:144460252-144460274 ATTTAATAGAAGTCTTTACAGGG - Intronic
998742751 5:145223611-145223633 ATCTAATGGAAGTCTAAACATGG + Intergenic
1003291065 6:4778169-4778191 TTCCAGGTGAAGTCTGTACAGGG + Intronic
1004802159 6:19160933-19160955 ATCCAAGAGAAGTATGTTAAAGG + Intergenic
1004891037 6:20100894-20100916 ACCCAATAGAAGTCTCCAAAAGG + Intergenic
1007459455 6:42007379-42007401 GTCCAATTGAAGTCAGGACAAGG + Intronic
1008362636 6:50639514-50639536 ATCCAATTGAAGTCTATAAGGGG + Intergenic
1009975208 6:70664696-70664718 AACCAATAGAAGCTTTTACACGG - Intergenic
1014717612 6:124884822-124884844 CTCCAAGAGATGTATGTACATGG - Intergenic
1015176930 6:130320080-130320102 ATCCAAAAGAAGGCAGTAAAAGG + Intronic
1021769163 7:23981316-23981338 ATTGAATAGAAGTATGTGCATGG + Intergenic
1026375764 7:69749198-69749220 AAGGAATAGAAGTCTGTATAAGG - Intronic
1029807701 7:103014099-103014121 ACTCAATATTAGTCTGTACAGGG - Intronic
1037026743 8:14047764-14047786 ATCCAATAGAAATCGGTTCGTGG - Intergenic
1038781293 8:30570255-30570277 ATACACTAGAATTTTGTACAGGG - Intronic
1039805870 8:40997534-40997556 ATTAAATAGAAGTCTGGGCATGG - Intergenic
1042737361 8:72004410-72004432 CTCCAATGGTAGTCTGTAAAGGG + Intronic
1042962321 8:74317064-74317086 ATGCAATGGAAATCTGTGCATGG - Intronic
1044337721 8:91007208-91007230 ATCCAATAGAAGTCTGTACATGG - Intronic
1049527124 8:143132975-143132997 ATCCAGGAGAAGTCTCAACAAGG - Intergenic
1051914595 9:22193125-22193147 ATACAAAAGAAGTCTACACAAGG - Intergenic
1059717534 9:116927595-116927617 TTACAATAGAAGTCTGTACTAGG + Intronic
1186160061 X:6768036-6768058 GTCCAATTGAAGTCTGTTCCTGG - Intergenic
1186790836 X:12996962-12996984 TTCCATTAGAAGTCTGGAAATGG + Intergenic
1188430675 X:30103251-30103273 ATTCAATAGAAGGCTGATCAAGG - Intergenic
1195426286 X:104735422-104735444 TTGCTATAGAAGTCTGTGCATGG + Intronic
1195742036 X:108074631-108074653 CTATAATAGAAGTCTGAACAGGG + Intronic
1199045922 X:143172001-143172023 ATCCAATAGATGTCTAGACAGGG + Intergenic
1199571607 X:149272293-149272315 CTCGGATAGAAGTCTGTTCAGGG - Intergenic
1201424580 Y:13834103-13834125 ATCAAGTAGAAGTATGTGCAAGG + Intergenic