ID: 1044345786

View in Genome Browser
Species Human (GRCh38)
Location 8:91102866-91102888
Sequence TTGTGGTTTGGTATTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044345779_1044345786 22 Left 1044345779 8:91102821-91102843 CCAGAGTTATGCAACTTGACCCA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1044345786 8:91102866-91102888 TTGTGGTTTGGTATTGAAGATGG 0: 1
1: 0
2: 1
3: 24
4: 255
1044345783_1044345786 2 Left 1044345783 8:91102841-91102863 CCAGGTGAGGAACAGTGTTTTGC 0: 1
1: 0
2: 0
3: 6
4: 145
Right 1044345786 8:91102866-91102888 TTGTGGTTTGGTATTGAAGATGG 0: 1
1: 0
2: 1
3: 24
4: 255
1044345782_1044345786 3 Left 1044345782 8:91102840-91102862 CCCAGGTGAGGAACAGTGTTTTG 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1044345786 8:91102866-91102888 TTGTGGTTTGGTATTGAAGATGG 0: 1
1: 0
2: 1
3: 24
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044345786 Original CRISPR TTGTGGTTTGGTATTGAAGA TGG Intronic
900273465 1:1807288-1807310 TTGTGTTTTTGTAGTGGAGACGG - Intronic
901554062 1:10017750-10017772 TTGTTGTTCTGTAATGAAGAGGG - Intergenic
904227758 1:29038267-29038289 TTGTGGTTTGATTTTAAAGAAGG - Intronic
904703411 1:32372717-32372739 TACTGGTTTGGTTTTGAAAATGG + Intronic
907583267 1:55591274-55591296 TTATGGTTTGGATTTGAAGATGG + Intergenic
908236629 1:62153404-62153426 TTGGGGTTTAGTATTGTAGGGGG + Intronic
908828189 1:68153555-68153577 TTATGGTGTGGTATTGGAGGAGG - Exonic
911555068 1:99333594-99333616 TTGTGGTTTGTTTTTTGAGATGG - Intergenic
912215510 1:107606864-107606886 TTGTTGTTTGTTACTTAAGAAGG + Intronic
913599785 1:120412205-120412227 TTGTGGTCTGGTTTTGGAGTTGG + Intergenic
914087275 1:144464469-144464491 TTGTGGTCTGGTTTTGGAGTTGG - Intergenic
914193052 1:145427440-145427462 TTGTGGTCTGGTTTTGGAGTTGG - Intergenic
914311333 1:146469738-146469760 TTGTGGTCTGGTTTTGGAGTTGG + Intergenic
914591084 1:149106352-149106374 TTGTGGTCTGGTTTTGGAGTTGG - Intergenic
915234131 1:154468076-154468098 TTTTGTTTTTGTATTGAAGAGGG + Exonic
916832152 1:168504126-168504148 TTGTGGCATCATATTGAAGAAGG - Intergenic
917983340 1:180288927-180288949 TTTTGTTTTGTTTTTGAAGAGGG + Intronic
918415206 1:184299033-184299055 TTGTGTCTTGGTCTTAAAGAAGG + Intergenic
920830057 1:209456425-209456447 ATGTGGTTTGGTATGGAACATGG - Intergenic
921205873 1:212848341-212848363 TTTTGGTTTGGTTTTTGAGATGG + Intergenic
921504943 1:215956343-215956365 TTGTGGTGTGGGTTTGAAAATGG + Intronic
923480824 1:234381716-234381738 TTGTGCTGTGGCAGTGAAGAAGG + Intronic
1063847041 10:10141746-10141768 TTTTGGTCTGGTATAAAAGAAGG + Intergenic
1064002555 10:11675593-11675615 TTTAGGTTAGGTCTTGAAGATGG + Intergenic
1064044934 10:12004874-12004896 TTGTGATTTGGTGTTGAAAACGG - Intronic
1064353789 10:14600314-14600336 TTGTCGCTTGGGATTGAAGGTGG - Intronic
1064391183 10:14943555-14943577 TTTTTGTTTGTTTTTGAAGATGG + Intronic
1064437811 10:15326630-15326652 TTGTTGTTTGTTTTTTAAGATGG + Intronic
1064680160 10:17803327-17803349 TTTTGGTTAGCTATTGATGATGG - Intergenic
1065395919 10:25237764-25237786 TAGTGGTTTGGTTGTGGAGAAGG - Intronic
1067078379 10:43200742-43200764 TGGTGGCTTGGTCTTGAGGATGG + Exonic
1067914643 10:50384153-50384175 TGGTGTTTTGTTATAGAAGACGG + Intronic
1070328022 10:75400520-75400542 TTGTGAGTGGGTGTTGAAGAGGG - Intronic
1070548945 10:77475403-77475425 TTGTGGTTTCGTGCTGAAGGAGG + Intronic
1071091091 10:81919581-81919603 TTGTGTGTTTGTATTAAAGATGG + Intronic
1071536514 10:86436848-86436870 TTATGGTATGATATTGAATATGG + Exonic
1071670416 10:87604087-87604109 TTGTGTTTTGTTTTTTAAGACGG + Intergenic
1072078957 10:92009020-92009042 TTGTGTTTTGCTATTGTAAAGGG + Exonic
1073765846 10:106682121-106682143 TTTTGGTTTTGTATTAGAGATGG - Intronic
1073879987 10:107969785-107969807 TTGTTGCTTAGTATTGAAGCTGG - Intergenic
1073965080 10:108979371-108979393 TTGTTGTTTGTTTTTTAAGAGGG + Intergenic
1075487708 10:122839381-122839403 TTGTGGTTTGATGTTGAGGATGG - Intronic
1075950618 10:126474546-126474568 ATTTGTTTTGGTATTTAAGAAGG - Intronic
1077663999 11:4092318-4092340 TTGTTCTTTGGTATTGATGTGGG + Exonic
1079440799 11:20513053-20513075 TTGTGGTTTTGTTTTGAAATAGG + Intergenic
1079615574 11:22488547-22488569 CTGTGATGTGGTATTGGAGATGG + Intergenic
1081690295 11:45073556-45073578 TTGTGGCCTGGTGGTGAAGAGGG - Intergenic
1081911495 11:46702807-46702829 TTGTGGTTTGGGATGGAACCCGG + Intronic
1083202294 11:61127806-61127828 TTTTGGTTTGGTTTTTAAGTAGG - Exonic
1083465163 11:62840753-62840775 TTTTGGTTTTTTAGTGAAGACGG + Intronic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1085907845 11:80786046-80786068 CTGTGGTGTGGTAGTGATGATGG + Intergenic
1087387809 11:97494594-97494616 TTGTGATTTGGTGGTGAAAAGGG + Intergenic
1088451306 11:109984160-109984182 ATGTGGATTGGAATTCAAGATGG - Intergenic
1090130263 11:124134924-124134946 TTCTCATTTGGTATTGGAGAAGG + Exonic
1090981841 11:131729341-131729363 TTGTGGACTGCTAATGAAGATGG + Intronic
1091463942 12:667434-667456 TTGTTGTAGGGTACTGAAGAAGG + Intergenic
1091808032 12:3370009-3370031 TTGTGGCTTTGTTTTGAGGATGG + Intergenic
1093385231 12:18544987-18545009 TTGTGGTTATGTATGGAAAATGG - Intronic
1095142947 12:38689116-38689138 TTGTTGTTTATTAATGAAGAGGG + Intronic
1096754240 12:53785482-53785504 TTATGCTTTGGTATGGAAGAAGG + Intergenic
1098539303 12:71635632-71635654 TTGTGGATTGAAATTGAACAAGG - Intronic
1099613213 12:84902924-84902946 TTGTGGTAAGGGATAGAAGAAGG + Intronic
1099638223 12:85244662-85244684 TTGTGGTATCATTTTGAAGAAGG + Intronic
1100454340 12:94737441-94737463 TTTTGGTTTGGTGTAGAAGTAGG + Intergenic
1100562997 12:95767850-95767872 CTGTGGTTTGGATTTGCAGAGGG + Intronic
1102052517 12:109873135-109873157 TTTTGGTTTTGTATAGAACAGGG - Intronic
1103314802 12:120044214-120044236 TTCTTGTTTGGAATTGGAGAAGG - Intronic
1106015033 13:25860987-25861009 TTGTGGTTTGATCTTGATCAGGG + Intronic
1106090385 13:26587197-26587219 TTGTTTTTTAGTATTGCAGAGGG + Intronic
1106108123 13:26752166-26752188 TTCTGGTCTGGGATTGTAGAAGG + Intergenic
1107649519 13:42530173-42530195 TTGTGGTGTGGGATTGAAGTTGG - Intergenic
1107998807 13:45888020-45888042 TTGGGGTTGGGTGTTGAAGGTGG + Intergenic
1108282844 13:48876477-48876499 TTGTGTTTTGTTATTGGTGAGGG - Intergenic
1108348964 13:49573120-49573142 TTGTGGTTTTGTTTTGAATTTGG - Intronic
1108739107 13:53316800-53316822 TTCTGGTTAGGTTTTGTAGAAGG + Intergenic
1111396677 13:87675065-87675087 TTATGGATTGGTTTTGAAAAGGG + Intronic
1113480926 13:110620259-110620281 TTGTGTGTTGGTCTGGAAGAAGG + Intronic
1113655006 13:112062632-112062654 GTTTGGTTTGGTTTTGAAGGAGG - Intergenic
1114004722 14:18300066-18300088 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1114650004 14:24278544-24278566 TTGTCATGTGGTATTGAATAGGG + Intergenic
1115416768 14:33144292-33144314 TTGTGCTTCCGTAGTGAAGAAGG + Intronic
1115635725 14:35288675-35288697 TTGTGGTATGGTATTTAAGCTGG - Intronic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1119579639 14:75765952-75765974 TTGTGGTTTGGTTTAGAAATGGG + Intronic
1120393264 14:83935372-83935394 TATTTGTTTTGTATTGAAGATGG + Intergenic
1121450409 14:94003416-94003438 GTGTGTTTTGGGATTGATGATGG - Intergenic
1122661048 14:103295187-103295209 TTTTGGTGTGGTATCAAAGAAGG + Intergenic
1123389184 15:19852312-19852334 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1124460130 15:29882266-29882288 TTGTGTTTTGGTTTTGGTGAAGG + Intronic
1124588406 15:31032324-31032346 TTGAGATATGGTATGGAAGAAGG + Intronic
1126587334 15:50301897-50301919 TTGGGGGTTGGAGTTGAAGATGG - Intronic
1130902718 15:88219192-88219214 TTTTGCTTTGATATTGAAGGGGG - Intronic
1131426680 15:92351096-92351118 TTGTGGTATGGGAGTGAAAAAGG + Intergenic
1131618356 15:94040438-94040460 GTTTGGTTTGGTTTTTAAGATGG - Intergenic
1136044535 16:27604931-27604953 TTGTTGTTTGGTTTTTGAGATGG + Intronic
1138004492 16:53318771-53318793 TTGTGAATTGGTATTGTAGGGGG - Intronic
1138203290 16:55105852-55105874 TTTTGGTTTGGTTTTTGAGAGGG + Intergenic
1139108479 16:63858801-63858823 TTGTGGTTTGATATAAAATAGGG + Intergenic
1140900819 16:79365716-79365738 TTGTGGCATGGTCTTGAAGATGG - Intergenic
1141324153 16:83039752-83039774 AAGTGATTTGGTATTGAAGGAGG - Intronic
1141581366 16:85001745-85001767 TTGTTGTTTAATATTCAAGATGG + Intronic
1141930528 16:87199375-87199397 TTGTCATTTGGTTTTGAAGCAGG - Intronic
1142472746 17:172356-172378 TTGGGGTTGGGTATTCAAGAAGG + Intronic
1142523637 17:522250-522272 TTGTGGTTTGTTACTGAGGCAGG - Intronic
1144897693 17:18554283-18554305 ATATAGTTTGGTAATGAAGAAGG + Intergenic
1145134679 17:20391436-20391458 ATATAGTTTGGTAATGAAGAAGG - Intergenic
1145238668 17:21226666-21226688 TTGTGGTTTGGGGTTGGAGTTGG + Intergenic
1146357990 17:32151039-32151061 TTGTGGTCTGTTCTTGGAGAAGG + Intronic
1146716879 17:35093854-35093876 CTGGGGTTTGGCATTGGAGAAGG - Intronic
1154532704 18:15363802-15363824 TTGAGGTTGGCTATAGAAGAAGG + Intergenic
1159411108 18:68075546-68075568 TTGTGTTTTGAAAATGAAGATGG + Intergenic
1159425794 18:68284511-68284533 ATGTGGTCTGGCATTGCAGATGG - Intergenic
1159538310 18:69743096-69743118 TTGTAGTTTGAAAATGAAGAAGG - Intronic
1160219924 18:76967504-76967526 TTGTGATTTGGTGTTGGAGGTGG + Intronic
1160219929 18:76967545-76967567 TTGTGATTTGGTGTTGGAGGTGG + Intronic
1160219941 18:76967660-76967682 TTGTGATTTGGTGTTGGAGGTGG + Intronic
1160219945 18:76967698-76967720 TTGTGATTTGGTGTTGGAGGTGG + Intronic
1164058625 19:21645415-21645437 TTGTAGTTTGTTATTAGAGATGG + Intergenic
1164451086 19:28365398-28365420 TGTTGGTTTGGTTTTGTAGATGG - Intergenic
1164687892 19:30181033-30181055 TTGTTATTTCGTATTGAATATGG - Intergenic
1165465116 19:35969746-35969768 TTGTTGTTTGCTTTTGTAGATGG + Intergenic
1166596291 19:44053096-44053118 TTGGAGTTTGATATTGAAGGGGG + Intronic
1168464773 19:56593686-56593708 TTGTGGTTTACTATAGAAAAGGG + Intergenic
926965064 2:18400906-18400928 TTTTTGTTTGTTTTTGAAGATGG + Intergenic
927419676 2:22917037-22917059 TTCTTGTTTGGTTTGGAAGATGG + Intergenic
927947628 2:27146634-27146656 TTGTTGTTTGTTTTTTAAGATGG + Intergenic
928047387 2:27949770-27949792 TTGTAGTGTGGTGTTGAAAAGGG + Intronic
930213738 2:48671205-48671227 TTTTGGTTTGGTTTTTGAGATGG + Intronic
930266325 2:49203752-49203774 TTGTGTTTTGGAGTTGAACATGG - Intergenic
931775975 2:65540743-65540765 CTGTGGCTTGGTAGTGAAAAAGG - Intergenic
934972757 2:98776080-98776102 CTGTGGTTTGGTTTTAATGAGGG + Intergenic
935900374 2:107785793-107785815 TTGAAGTTTGGTTTTGTAGAGGG + Intergenic
936458178 2:112691493-112691515 TTGTAGGGTGGTATTGTAGAAGG - Intergenic
937475761 2:122213961-122213983 TTGTGTATGGGTATTGAACAGGG - Intergenic
937684810 2:124683785-124683807 TTCTGTTTTTGTCTTGAAGAGGG - Intronic
938076726 2:128342845-128342867 TTGTGGTTTGATTTTGAACCAGG + Intergenic
939409009 2:141799655-141799677 TTGTGGTTCGGAAGTGAGGAGGG - Intronic
940522917 2:154774598-154774620 TTGTATTTTTGTATTGCAGAAGG - Intronic
940607385 2:155943292-155943314 TTGTTCTTTGGTATAGAAGAGGG - Intergenic
942545468 2:177058764-177058786 AAGTGGATTGGTAGTGAAGATGG + Intergenic
942804985 2:179919937-179919959 TTGTGGTTTAATTTTCAAGAAGG - Intergenic
945332950 2:208560682-208560704 GTGTGGTTTGGTTTTTGAGATGG - Intronic
945784797 2:214219835-214219857 ATTTGGTTTGGTATTTCAGATGG - Intronic
946664618 2:222035756-222035778 TTATGGCATGGTATTGAGGATGG - Intergenic
947790009 2:232860165-232860187 TTTTGTTTTTGTATTGGAGATGG + Intronic
947845552 2:233241079-233241101 TTGTGGTTTGGTCAGGAAGTGGG - Intronic
1168824773 20:802670-802692 TTGTAGCTTGGTACTGAAGACGG - Intergenic
1169687954 20:8297827-8297849 TTGAGGTTTAGAATTGAAGGTGG - Intronic
1170255342 20:14336738-14336760 TTTTGGTGTTCTATTGAAGAGGG + Intronic
1171096184 20:22334382-22334404 CTGTGGGTTGGTTTTGAAGTGGG - Intergenic
1172794865 20:37529603-37529625 TTGGGGTTTGGGAATAAAGAAGG + Intergenic
1172839703 20:37894993-37895015 TGGTGGCTTGGTATGGAAAAAGG + Intergenic
1175450663 20:59063672-59063694 TTGTGGTTTGGGAATTAGGAGGG - Intergenic
1176764657 21:13004409-13004431 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1178065133 21:28896194-28896216 TGCTGGTTTTGTTTTGAAGATGG + Intergenic
1180429236 22:15230856-15230878 TTGAGGTTGGCTATAGAAGAAGG - Intergenic
1182072257 22:27472005-27472027 TTGTGGTTTGGTTGTGCATATGG - Intergenic
949832531 3:8230823-8230845 TTGTGGAAGGGCATTGAAGATGG - Intergenic
950677722 3:14564772-14564794 CTGTGGTGGGGTGTTGAAGAAGG - Intergenic
951508505 3:23475983-23476005 TTGTGGATTAGTATTCAAGATGG + Intronic
952963169 3:38605423-38605445 TTCTGGTGGGGTAGTGAAGAAGG - Intronic
953865239 3:46577702-46577724 CTGGGGTTTGTTGTTGAAGAAGG + Exonic
954019762 3:47728898-47728920 TTTTTGTTTTGTTTTGAAGATGG - Intronic
954556009 3:51518331-51518353 TTGTTGTTTTGTTTTGGAGATGG + Intergenic
955720350 3:61874018-61874040 TTATAGTTTGATATGGAAGAAGG + Intronic
956093639 3:65693726-65693748 TTGTTGTTTTGTTTTGGAGATGG + Intronic
957144402 3:76404842-76404864 TTGTGGCTTGGTTGTGAATATGG + Intronic
957275227 3:78082270-78082292 TTTTCCTTTGGTATTCAAGATGG + Intergenic
957289156 3:78255292-78255314 TTGTGGATTGGAAGTGGAGAAGG - Intergenic
957373080 3:79321601-79321623 TAGTGTTTTGCTTTTGAAGAAGG - Intronic
957548570 3:81673350-81673372 ATTTGGTTTGGCATTGAACAGGG - Intronic
958665646 3:97134623-97134645 TTATGCTTTGTTATTAAAGATGG + Intronic
960124415 3:113982837-113982859 TTGTTTTTTTGTTTTGAAGAGGG - Intronic
960765783 3:121128329-121128351 TTTGGGTATGGTATTAAAGAAGG + Intronic
960806177 3:121585974-121585996 TTGTGGTCTGTTATTGGAGGAGG - Intronic
961076877 3:123991018-123991040 TTTGGGTTTGGAATTGGAGATGG + Intronic
964160432 3:153639457-153639479 TTTTGGTTTGGTTTTTGAGATGG - Intergenic
965119345 3:164531518-164531540 TGGTGTTTTGCTATTGAAGTTGG + Intergenic
967263307 3:187666971-187666993 TTGTGCTTTGACATTGAAAAGGG - Intergenic
968245266 3:197139662-197139684 TTGTGGTGTGGGATTCAACATGG + Intronic
972658093 4:41085773-41085795 TTGTAGTTTGGCAATGAAAAAGG - Intronic
973063605 4:45761463-45761485 TTGTGGTATCGTATTGAAGCAGG + Intergenic
975560962 4:75708103-75708125 TTCTGGTTTGAAATTGAAAAGGG - Intronic
977458004 4:97286656-97286678 TGAGGGTTTGGTATTGAATAGGG - Intronic
978979979 4:114932111-114932133 TTTTGATTTGGTATTGAATTTGG - Intronic
979225190 4:118277111-118277133 TTGTGGTTTAGTGTTGAAACTGG - Intergenic
981216724 4:142178417-142178439 TTATGGTTAGGGTTTGAAGACGG + Intronic
981432146 4:144673416-144673438 TTGTGGTAATGTAATGAAGAGGG + Intronic
982420603 4:155192251-155192273 CTGTGGTTTTATATTTAAGAAGG + Intergenic
983821489 4:172198784-172198806 TTGTGGTTTGGGTTTGATGCTGG - Intronic
984799469 4:183700385-183700407 TTATGGTTTTCTAATGAAGATGG - Intronic
987204963 5:15615486-15615508 TTGTGTTTTGTTTTTGAAGGAGG + Intronic
990389345 5:55302892-55302914 TTTTGGTTTTGTGTTTAAGATGG + Intronic
993227272 5:85182818-85182840 TTGTAGTTTGGTATGCAGGAGGG - Intergenic
994294772 5:98077657-98077679 TTTTGTTTTTGTATTTAAGATGG - Intergenic
994692813 5:103038705-103038727 TTGTGGTTTTGTTTTTAAGGAGG - Intergenic
995449676 5:112286783-112286805 TTTTGGTTTTGTTTTGAAGATGG - Intronic
999103332 5:149046200-149046222 CTGGGGTTTGGTATGGCAGAAGG - Intronic
999348889 5:150848105-150848127 TTGGGGTATTTTATTGAAGATGG + Exonic
1000639262 5:163682199-163682221 TTGTGGTTTCATATTGAATGTGG - Intergenic
1002698661 5:181107325-181107347 TTGTGGTTTATTATTAGAGATGG + Intergenic
1004125747 6:12871469-12871491 ATGTGGTTTGTTATGGAAAATGG + Intronic
1005229330 6:23682093-23682115 TTGTGGTTTGGTGGTGGTGATGG + Intergenic
1005285829 6:24325967-24325989 TTGTGGTCTGGGATTCAACATGG - Intronic
1005810912 6:29515426-29515448 TTTTGGTTTTGTTTTTAAGACGG + Intergenic
1008437908 6:51497649-51497671 TTGTGGGTTGGTGAAGAAGAGGG - Intergenic
1008976819 6:57436826-57436848 TTGTAGTTTGGTTTTGAAATTGG + Intronic
1009164963 6:60329771-60329793 TTTTGGTTTGGTTTTGAAATTGG + Intergenic
1009816059 6:68737279-68737301 TTGTGGTTTGTTATTTAGTAGGG + Intronic
1009828785 6:68902605-68902627 TGGTTGTTTGATATTGAAAAAGG + Intronic
1011198025 6:84802508-84802530 TGGTGGTTTCATTTTGAAGATGG + Intergenic
1011257879 6:85442460-85442482 TTATAGTTAGGTATTGAACATGG - Intergenic
1011269292 6:85560462-85560484 TTGTGGTTGGCTATGGATGAAGG + Intronic
1011810261 6:91123701-91123723 TTGTGGTTAGGAGTTGGAGAAGG + Intergenic
1015557206 6:134475390-134475412 CTGTGGTTTGGTATGAAATAAGG - Intergenic
1016149658 6:140723938-140723960 TTTTGGTTTGCTCTTAAAGAGGG + Intergenic
1017306951 6:152929505-152929527 TGGTGGATTGGTATCCAAGATGG + Intergenic
1018055040 6:160044837-160044859 TTCTGATTTGGTTTTGAGGAGGG - Intronic
1021681710 7:23139765-23139787 TTGTAGTTTTATATAGAAGAGGG + Intronic
1023117634 7:36877819-36877841 TTGGGGTTTGGAACTGAATAGGG - Intronic
1023165817 7:37342848-37342870 TGGTGGTTTGGTATGAAAAACGG + Intronic
1023291100 7:38669964-38669986 TTATGGTGTTGGATTGAAGATGG - Intergenic
1023689816 7:42774121-42774143 TTGGGGTATGGTGTGGAAGATGG - Intergenic
1024136278 7:46412353-46412375 TTGTGGAATGCTATTGAAGCAGG + Intergenic
1024614648 7:51100896-51100918 TTTTTGTTTCTTATTGAAGACGG - Intronic
1026380709 7:69796604-69796626 TTGTGGTGTGGTCTGGAAGAAGG + Intronic
1026621969 7:71957670-71957692 TTTTGTTTTGTTTTTGAAGAAGG + Intronic
1027516695 7:79150352-79150374 TTTTGGTTTCTTAATGAAGATGG + Intronic
1027524923 7:79256301-79256323 ATGTAGTCTGGTATTCAAGATGG - Intronic
1029135167 7:98365473-98365495 TTTTGGTTTGGTTTTTGAGATGG + Intronic
1030214821 7:107033463-107033485 TTGTGGCTTGGTGGTTAAGAGGG + Intergenic
1031185007 7:118466103-118466125 TTGTGCTTTGATTTTGATGAAGG + Intergenic
1032632134 7:133664832-133664854 TTTTGGTAAGGTAATGAAGAAGG + Intronic
1033460462 7:141542733-141542755 TTTTGGTTTGTTTTTGCAGAGGG - Intergenic
1034340648 7:150352511-150352533 TTTTGGTTTGGTTTTTGAGACGG + Intergenic
1034831073 7:154307915-154307937 TTGTGGATTGGTTTTGAAGCAGG + Intronic
1039535179 8:38304110-38304132 TTTTGGTCTGGCATTGAGGAGGG - Intronic
1040847138 8:51855355-51855377 TTTTTTTTTGGTATTAAAGACGG - Intronic
1043299966 8:78716125-78716147 TTTTGGTTTGTTTTTTAAGACGG + Intronic
1043481445 8:80656753-80656775 TTGAGACGTGGTATTGAAGAGGG - Intronic
1044187668 8:89275234-89275256 TTGTAGTTTATTATTGAACAAGG - Intergenic
1044267622 8:90202503-90202525 TAGAGGTATGGAATTGAAGAAGG - Intergenic
1044345786 8:91102866-91102888 TTGTGGTTTGGTATTGAAGATGG + Intronic
1044906992 8:97014931-97014953 TTGCTGTTTGGTGTTGAAAAGGG + Intronic
1045412841 8:101936127-101936149 TTGAGGTTTGGTAGAGAAGAAGG + Intronic
1045871591 8:106933882-106933904 TTGTGGTTAGGGATTGGAGCTGG + Intergenic
1045919803 8:107516007-107516029 TTGTAGTTTCCTATTGAAGGGGG + Intergenic
1046063655 8:109171630-109171652 GTGTGATTTGGTATTTAAAATGG + Intergenic
1046151630 8:110234289-110234311 TTATGGTTTGGTAATAGAGACGG + Intergenic
1046830792 8:118743643-118743665 TTTTTTTTTGGTGTTGAAGATGG + Intergenic
1047029767 8:120863512-120863534 CTGTGGTTTAGTATTCAAGGGGG - Intergenic
1047835976 8:128692008-128692030 TTGTGAGTGGGTATTGAATATGG + Intergenic
1048809054 8:138268614-138268636 ATGTGGATTGTTGTTGAAGAAGG - Intronic
1049459264 8:142715827-142715849 TTGTTGTTTGCTTTTGAAGTAGG - Intergenic
1049987367 9:964192-964214 TTGTGGTTTTTTTTTTAAGAAGG + Intronic
1052959911 9:34286581-34286603 TTGTGGTGGGGTAATAAAGAAGG + Intronic
1053219720 9:36301982-36302004 GAGTGGTTTAATATTGAAGAGGG - Intronic
1053710413 9:40801521-40801543 TTGAGGTTGGCTATAGAAGAAGG + Intergenic
1053832014 9:42093338-42093360 TTTTGGTTTGGTTTTTGAGATGG - Intronic
1054420321 9:64922310-64922332 TTGAGGTTGGCTATAGAAGAAGG + Intergenic
1054949355 9:70833320-70833342 ATGAGGTTTGGGATTGCAGAAGG - Intronic
1055368676 9:75573611-75573633 TTGTCCTTTGTCATTGAAGATGG + Intergenic
1056642586 9:88384028-88384050 TTGTGATTTGGAGTGGAAGAAGG - Intergenic
1057418673 9:94889490-94889512 TTGTTGTTTGTTTTTGGAGATGG + Intronic
1057788059 9:98103178-98103200 TTGTTGTTTGTTTTTGGAGATGG - Intronic
1058428941 9:104901036-104901058 TTCTTGCTTGGTATTGCAGATGG - Intronic
1058552304 9:106127861-106127883 TGGTGGTTTGGCATTGAAGATGG + Intergenic
1059369286 9:113812627-113812649 ATGTGGTGTGGACTTGAAGAAGG - Intergenic
1060776148 9:126376427-126376449 TTGTGGGTTGGGATTTAAGATGG + Intronic
1061653385 9:132068925-132068947 TGGTGGTTTGGTTTGGGAGAAGG - Intronic
1062225690 9:135448592-135448614 AGATGGCTTGGTATTGAAGAAGG + Intergenic
1186053868 X:5628226-5628248 ATATGGTTTGGTATTAGAGAAGG + Intergenic
1187245979 X:17553213-17553235 TTGGGGTATGGAATTGAACAAGG + Intronic
1193027421 X:76859182-76859204 TTGTGGTTTTGTGTTGAATATGG - Intergenic
1193752181 X:85359378-85359400 TGGTTGTTTGGCATTAAAGATGG + Intronic
1194449748 X:94029904-94029926 CAGTGGTTGGGAATTGAAGAAGG - Intergenic
1195975368 X:110520862-110520884 CTGGGGTTTGTTGTTGAAGAAGG + Intergenic
1196108183 X:111918237-111918259 TAGTAGTTTGTTATTGAAGAGGG + Intronic
1196622537 X:117839856-117839878 ATGAGGTATGGTATTAAAGATGG - Intergenic
1198981529 X:142402839-142402861 TTGTGGTTTTGTAATGAAGTAGG + Intergenic