ID: 1044352820

View in Genome Browser
Species Human (GRCh38)
Location 8:91186477-91186499
Sequence ATACTTAGAGATCTCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044352820_1044352827 24 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352827 8:91186524-91186546 ATGGGGCTTACTAGGATATATGG No data
1044352820_1044352826 16 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352826 8:91186516-91186538 GGGTAAAGATGGGGCTTACTAGG No data
1044352820_1044352823 5 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352823 8:91186505-91186527 AAAGCTTAAAAGGGTAAAGATGG No data
1044352820_1044352825 7 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352825 8:91186507-91186529 AGCTTAAAAGGGTAAAGATGGGG No data
1044352820_1044352828 28 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352828 8:91186528-91186550 GGCTTACTAGGATATATGGTTGG No data
1044352820_1044352822 -4 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352822 8:91186496-91186518 GTATCTCTGAAAGCTTAAAAGGG No data
1044352820_1044352821 -5 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352821 8:91186495-91186517 AGTATCTCTGAAAGCTTAAAAGG No data
1044352820_1044352824 6 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352824 8:91186506-91186528 AAGCTTAAAAGGGTAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044352820 Original CRISPR ATACTTAGAGATCTCATGAC AGG (reversed) Intronic
906280181 1:44547858-44547880 CCACTTCAAGATCTCATGACTGG - Intronic
907098860 1:51808641-51808663 ATACTTAGACATGTAATGAATGG + Intronic
907531113 1:55098349-55098371 ATACTTATAGATCTGTTGACAGG + Intronic
908175780 1:61553807-61553829 ATACTTGAAGACCTCCTGACAGG - Intergenic
910466598 1:87506905-87506927 ACAATTAGAGATTTCCTGACAGG - Intergenic
911660649 1:100497976-100497998 AATCTTAAAGATATCATGACAGG - Intronic
912561338 1:110553826-110553848 TTACTCAGATAACTCATGACTGG - Intergenic
915631023 1:157154393-157154415 TTCCCTAGAGATCTCATCACAGG - Intergenic
919638649 1:200028778-200028800 AGACTCAGAGAGCTCATGACAGG - Intronic
920349586 1:205329063-205329085 ATATTTAGATATCGCATGCCAGG + Intergenic
1063856696 10:10263040-10263062 AAACTCAGAGATGTCATCACTGG - Intergenic
1064840873 10:19590636-19590658 ATAGTTAGATATCTCACCACCGG + Intronic
1066498064 10:35961717-35961739 ATACATAGTGATCTCAGGACAGG + Intergenic
1066625765 10:37403989-37404011 ATACATAGTGATCTCAGGACAGG + Intergenic
1068745110 10:60521512-60521534 ATAATTAGAAAATTCATGACAGG + Intronic
1070898604 10:80007481-80007503 ATACTTGGAGTTCTCATCTCTGG + Intergenic
1073628524 10:105124020-105124042 CTATTAAGCGATCTCATGACTGG + Intronic
1074241668 10:111645649-111645671 ACACTTAGAGAACTCAGGATAGG - Intergenic
1078219158 11:9336882-9336904 TTACTAAGAAATCTCAGGACAGG - Intergenic
1078843597 11:15101767-15101789 AGGCTTAGAGATCTCCTGGCTGG + Intergenic
1079985925 11:27200932-27200954 ATTCCCAGAGATCTCATGACTGG + Intergenic
1084540001 11:69780266-69780288 CTACTTAGGGACCTCATGAGTGG + Intergenic
1088879713 11:113963862-113963884 ATCCTGAGAGGTCTCATCACTGG + Intergenic
1091647349 12:2283966-2283988 ATGCTCAGAGATCTCATCCCTGG + Intronic
1094364702 12:29667949-29667971 TTACTCAGGGATCTCATGGCTGG + Intronic
1097033004 12:56103172-56103194 ATACCTAGACATCTCATCTCAGG + Exonic
1098428368 12:70391684-70391706 ATAATGAGAGATCACATGAAAGG - Intronic
1106316021 13:28594472-28594494 ATACCTAGAAATCAAATGACTGG - Intergenic
1107381211 13:39858205-39858227 CTACTTAGAGAACTCAAGAATGG + Intergenic
1108785584 13:53897340-53897362 AAACTTCTAGATCCCATGACTGG - Intergenic
1109462391 13:62678792-62678814 ATACTGAGAAAATTCATGACAGG + Intergenic
1116259047 14:42598906-42598928 ATACTTAGAGCTCATATAACAGG + Intergenic
1124831220 15:33151322-33151344 ATGCTTACAGTTCTTATGACTGG + Intronic
1126999870 15:54490188-54490210 ATACTTAGAGTTATCATAGCAGG + Intronic
1133465470 16:6022886-6022908 ATACTTAGAAATCTTTTCACAGG - Intronic
1135842506 16:25889512-25889534 ACACTTAGAAATCTGAGGACTGG + Intronic
1144705182 17:17363420-17363442 AGACTTAGAGATGCCATGAGAGG - Intergenic
1148945168 17:51255842-51255864 ATACTTTGAGAGCCCAGGACAGG - Intronic
1151710855 17:75805492-75805514 ATACATAAAAATCTCATTACAGG + Intronic
1156294058 18:35774039-35774061 GGACTTGGAGATCTCATGCCAGG - Intergenic
1156727258 18:40144074-40144096 AGACTTACAGATCTCATGGTTGG - Intergenic
1157028062 18:43870975-43870997 AAACATAGAGAACTCATGAATGG + Intergenic
1157028816 18:43879838-43879860 ATAGTTATAGATCTCAAGAGAGG + Intergenic
1160578552 18:79870724-79870746 TTAGTTATAGATTTCATGACTGG + Intronic
927751065 2:25671753-25671775 ATCCTTAGAGAACTCATAAAAGG + Intronic
931421747 2:62134544-62134566 TAACTCAGAGATCTTATGACTGG + Intronic
933628846 2:84633589-84633611 TTTCTTAGAGACCTCATGATGGG + Intronic
936560350 2:113533133-113533155 AATCTTAGATATCTTATGACTGG + Intergenic
938232642 2:129674993-129675015 ATACTTGGAGATCTCATGCCCGG + Intergenic
946028339 2:216686088-216686110 AGACTTAGAGAACTACTGACTGG + Intronic
951480239 3:23153172-23153194 ATGAGTAGAGCTCTCATGACTGG - Intergenic
962931014 3:140035993-140036015 CTACTTTGTGAGCTCATGACAGG - Intronic
963581645 3:147133443-147133465 ATGCTTAGAAATTTTATGACAGG + Intergenic
964054845 3:152441313-152441335 AAAATTAGAGATCAAATGACAGG + Intronic
965244130 3:166244823-166244845 ATGCTTAGATATTTCATGAGTGG + Intergenic
972309547 4:37867187-37867209 ATACTTACAGATATGATGACAGG - Intergenic
976598795 4:86918885-86918907 AGACTGAGAAATCCCATGACAGG + Intronic
976859265 4:89643438-89643460 ATACATAGAGATTTGATGAATGG + Intergenic
977087762 4:92625977-92625999 ATACTTAGAGATCTGATTTTTGG + Intronic
980696108 4:136357724-136357746 ATAATTAGAGATCACAAGATAGG + Intergenic
987991386 5:25217096-25217118 AAACTCAGAAATCCCATGACTGG + Intergenic
988371146 5:30368784-30368806 ATACTTAAATATTTCATAACTGG + Intergenic
988886716 5:35565749-35565771 ATGCTTTGAGATCTCATGGTTGG - Intergenic
988942017 5:36156369-36156391 GTACATAGATATCTGATGACTGG + Intronic
990705472 5:58524149-58524171 ATATTTAGAGAATTCATGATAGG - Intergenic
990785827 5:59418592-59418614 ATATTTAGAGAACAGATGACTGG + Intronic
992215347 5:74519699-74519721 ATAATTAAATATCTCCTGACTGG - Intergenic
994063638 5:95509974-95509996 ATCTTTATAAATCTCATGACTGG - Intronic
995456266 5:112355746-112355768 ATACTGAGAGATCTTAGAACTGG + Intronic
996887049 5:128369646-128369668 ATACTTGGAGCTCTAATCACTGG + Intronic
1003142612 6:3484192-3484214 ATGCTTAGAGGGCTAATGACGGG - Intergenic
1004024876 6:11808575-11808597 ATATTTATAAATCTCATGTCTGG + Intergenic
1014901020 6:126965531-126965553 CTACTTGGTGTTCTCATGACTGG + Intergenic
1015363057 6:132363425-132363447 TTACTTAAAGAACTCATGGCTGG + Intronic
1029649139 7:101878966-101878988 CTACTTTAAGATCTCGTGACTGG - Intronic
1031071424 7:117166407-117166429 ATACTTAAATATCTCATAATGGG + Intronic
1034860659 7:154592114-154592136 GGACTTTGAGATCTGATGACAGG + Intronic
1037680417 8:21092703-21092725 AGACTTAGAGATGTCATGTTAGG - Intergenic
1038043211 8:23744227-23744249 ATGCTTAGAAATCTCATGCTTGG - Intergenic
1039334789 8:36576944-36576966 AGACTTTGGGATCTCAGGACAGG + Intergenic
1042947188 8:74166932-74166954 ATCCTTAAAGAACTCATGGCAGG + Intergenic
1044352820 8:91186477-91186499 ATACTTAGAGATCTCATGACAGG - Intronic
1048788025 8:138072675-138072697 AAACTTAGCAATCTCATTACTGG + Intergenic
1049892328 9:82214-82236 AATCTTAGATATCTTATGACTGG - Intergenic
1050086916 9:1975560-1975582 CTCCTTGGAGCTCTCATGACAGG + Intergenic
1052242092 9:26285870-26285892 AAACTTAGAAAACTCATCACTGG - Intergenic
1053733747 9:41083291-41083313 AATCTTAGATATCTTATGACTGG - Intergenic
1054694664 9:68348261-68348283 AATCTTAGATATCTTATGACTGG + Intronic
1057334579 9:94145919-94145941 ATGGTTAGGGATGTCATGACTGG + Intergenic
1058009889 9:99965168-99965190 ATAATTAGTGATCTCAGGATTGG + Intronic
1059752088 9:117257507-117257529 AAGCTTAAAGATCTCTTGACAGG + Intronic
1059805408 9:117794247-117794269 ATACTTAAAATTCTAATGACTGG - Intergenic
1189170270 X:38902652-38902674 AGACATATATATCTCATGACTGG - Intergenic
1191636781 X:63386839-63386861 CCACCTAGATATCTCATGACTGG + Intergenic
1197335747 X:125207049-125207071 ATACTTAGGGATTTCATGAAAGG + Intergenic
1197495653 X:127175136-127175158 ATAGTGAGCAATCTCATGACAGG - Intergenic
1198665972 X:139023523-139023545 ATTCTTAGAAATGTAATGACTGG - Intronic
1199762910 X:150918797-150918819 AGACTGAGAGAGCTCATGCCAGG + Intergenic