ID: 1044352823

View in Genome Browser
Species Human (GRCh38)
Location 8:91186505-91186527
Sequence AAAGCTTAAAAGGGTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044352820_1044352823 5 Left 1044352820 8:91186477-91186499 CCTGTCATGAGATCTCTAAGTAT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1044352823 8:91186505-91186527 AAAGCTTAAAAGGGTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044352823 Original CRISPR AAAGCTTAAAAGGGTAAAGA TGG Intronic
No off target data available for this crispr